Science 103 Spring 2006 Outline 16: Transcription, Translation, and Mutation Reading: Transcription, Translation & Mutation P 572-579 PROTEIN SYNTHESIS DNARNAProtein = The Central Dogma 1. Gene Expression Expressing a gene = Synthesizing the corresponding protein. Involves 2 steps: (a) Transcription (b) Translation 2. Transcription (a) Overall Process Gene (DNA) (b) Functions (i) (ii) (c) Location (d) Process A single-stranded RNA copy of the DNA is made by RNA polymerase: (i) RNA pol binds to and moves down the DNA, separating the strands. (ii) As it goes, it pairs complementary nucleotides with ONE strand, the template strand (*NOT coding strand as in the book!) making a copy of the information in the gene: eg. DNA: RNA: ATCGGCTTCAA (iii) When it reaches a termination site, the RNA detaches and the DNA re-zips. (iv) mRNA passes out of the nucleus through the ______________________. Figure 25.14 3. Translation (a) Overall Process (b) Location (c) Classes of RNA Used (i) mRNA (ii) Transfer RNA (tRNA) An adapter molecule that picks up a specific amino acid and pairs to the complementary sequence of nucleotides on the mRNA. (iii) Ribosomal RNA (rRNA) Ribosomes = (d) Genetic Code (i) Description (ii) Codon Table 25.3 (e) Process Figures (i) mRNA binds to the ribosome. (ii) The first tRNA (carrying its amino acid) with the anticodon corresponding to the first codon (always AUG) binds. (iii) The second tRNA (with amino acid) with the anticodon corresponding to the second codon binds. (iv) A peptide (covalent) bond forms between the 2 amino acids and the first amino acid detaches from its tRNA. (iv) Ribosome moves one codon to the right. (v) A tRNA (plus amino acid) with the anticodon corresponding to the third codon binds and the first tRNA (empty) leaves. (v) The ribosomes move down the mRNA until they reach a stop codon. The ribosomes detach from the mRNA and the protein is released. 4. Fate of Proteins Where in the cell would translation occur if a protein is to be: (a) Secreted? (b) Used in cell? 5. Translate the Following mRNA sequence: mRNA Protein UGAUAUGACGUCGCAGCAAAGUUAAGGAGGGCC Mutation 1. Description 2. Somatic Mutations 3. Germ-Line Mutations (Only when genetic change occurs in germ-line cells will it be passed on to offspring). (a) Importance (b) Do All Mutations in Germ-Lines Increase Genetic Fitness? 4. Effect on Evolution 5. Evolution Rate Examples of Mutation Point Mutations Alterations in one or a few base pairs. 1. Insertion Example: Polypeptide chain DNA RNA Mutated DNA RNA Polypeptide chain Consequences? 2. Deletion Leucine Proline Stop AAT AGG TAT T Example: DNA AAT GGT ATT AAG GTA TT RNA Polypeptide chain Consequences? 3. Base Substitution Eg. Figure 25.16 Example 1: DNA AAT GGT ATT AAC GGT ATT RNA Polypeptide chain Consequences? Example 2: DNA RNA Polypeptide chain Consequences? AAA GGT ATT