If all cells have the same genetic information…why
don’t all cells look and act the same way?
The types of human cells shown below are different from one another, even though
they all originated from the same fertilized egg and contain the same genetic
information.
Explain why these genetically identical cells can differ in structure and function.
1. _________________________________________________________
___________________________________________________________
2. _________________________________________________________
___________________________________________________________
Mutations
What is a mutation?
_________________________________________________________




Most mutations are _________________ and ________________.
However, mutations also allow an organism to be more adaptable to a change
in the environment.
Mutations which occur in the body cells of sexually reproducing organisms
CANNOT be passed on to the offspring, although they may result in disease
or death for the organism involved.
ONLY mutations which occur in sex cells or gametes can be passed to
the offspring.
Along with crossing over and genetic recombination, mutation provides for a
source of variation in sexually reproducing individuals.
Types of Mutations
Gene Mutation
Chromosomal Mutation

Deletion:

Extra Chromosome

Insertion:

Missing Chromosome

Substitution:

Change in Structure of a
chromosome
What Causes a Mutation?

Mutations can be caused by randomly occurring mistakes during replication,
mitosis and meiosis.

Mutations can also be caused by environmental factors like radiation, ultra
violet light and chemical exposure.
Gene Mutation Examples
I. Normal Hemoglobin:
CTGAGTCCTGAGGAGAAGTCT
mRNA: __________________________________________
Amino Acids: __________________________________________
Abnormal Hemoglobin:
CTGAGTCCTGTGGAGAAGTCT
mRNA: _________________________________________
Amino Acids: _________________________________________
Type of gene mutation: _____________________________________
Disease: ________________________________________________
II. Some gene mutations occur on genes found on the sex chromosomes and are
called sex-linked mutations. The disease then shows up more frequently in males
because they do not have two alleles for this trait. Color blindness and hemophilia
are examples.
Chromosomal Mutation Example
The human cell has __________ chromosomes arranged in __________ pairs.
Pairs 1through 22 are called ________________________________________
Pair 23 is called ___________________________________ and determines the
sex of the individual.
During Meiosis chromosomes may fail to separate causing a chromosomal mutation.
Genetic Testing
Genetic Counselors are professionals that use many genetic testing
techniques to study the DNA of individuals. People who have a history
of genetic diseases in their families may want to meet with a genetic
counselor before getting pregnant to determine the likelihood of
passing on a genetic disease to their unborn child.
Tools for genetic testing:
1. Karyotype: An enlarged photograph of chromosomes that are
arranged in pairs.
Would this tool be more helpful
for discovering gene mutations
or chromosomal mutations?
_______________________
Why? __________________
2. Genetic Screening: Simple blood and urine tests that look at
human DNA, RNA and proteins to look for symptoms of genetic
diseases.
Who would benefit from these tests?
_____________________________________________________
_____________________________________________________
3. Pedigree: A special family tree that shows a genetic disease and
how it has been passed on.
If this was a pedigree for a genetic disorder how many people in the
family would show the symptoms of the disease? ________________
How many people are carriers of the disorder but do not have show
symptoms of the disorder? ________________________________
Do you think this genetic disorder is dominant or recessive? Explain
your answer.
_____________________________________________________
4. Amniocentesis: Amniotic fluid is the fluid surrounding the baby in
the mother’s stomach and contains cells from the baby. During this
test, fluid is withdrawn and can be used for karyotyping or chemical
analysis.
Why would a woman choose to have this test done?
_____________________________________________________