1
Self-Organization, Layered Structure, and Aggregation Enhance Persistence of a
Synthetic Biofilm Consortium
Supporting Information S1:
Construction of the synthetic biofilm-forming consortium
S1.1 Constructing the metabolically-compromised (blue) strain
The symbiotic biofilm consortium consists of two engineered populations of Escherichia
coli MG1655, one of which is deficient in biofilm formation but otherwise healthy, while
the other is metabolically compromised but capable of biofilm formation (Fig. 1A). As
mentioned in Materials and Methods, to construct the “blue” strain, we first deleted
dapD, the gene encoding tetrahydrodipicolinate N-succinyltransferase, to create strain
MG1655∆DapD (36). We used the lambda red recombinase plasmid pKD46 and the
procedure outlined in (37). The chromosomal inserts to replace dapD were constructed
by PCR with template plasmid pKD4. The primers used were:
dapD-P1-fwd: 5’ATGCAGCAGTTACAGAACATTATTGAAACCGCTTTTGAACGCCGGTGTAGGC
TGGAGCTGCTTC
and dapD-P2-rev: 5’TTAGTCGATGGTACGCAGCAGTTCGTTAATGCCGACTTTGCCGCATATGAATA
TCCTCCTTA;
Recombinant clones were selected with 50 g ml-1 kanamycin, cured at 42° C,
and tested with colony PCR reactions using internal primers to confirm the presence of
the kanamycin resistance gene and absence of the target genes. Plasmid pCP20,
containing the Flp recombinase, was transformed into cells containing successful
kanamycin inserts to remove the inserts (38). Finally, clones were again cured at 42° C
to remove pCP20, and the same colony PCR reactions with internal primers were
2
repeated to confirm the deletions of target genes and of the kanamycin resistance gene
insert.
S1.2 Constructing the biofilm-deficient (yellow) strain
To construct a biofilm-deficient version of MG1655, we deleted three groups of genes
that are implicated in biofilm formation. We used the lambda red recombinase system
detailed in S1.1 to make these deletions.
First, a factor which is involved in strong surface adhesion of E. coli biofilms,
although not as clearly involved in the formation of three-dimensional structure, is the
presence of type I pili (also called fimbriae). These cell-surface appendages form catch
bonds whose binding is characteristically tighter under higher stress (39, 40). Genes
responsible for fimbriae lie in the fimA–fimH locus, and the key gene whose product
mediates catch bond formation is fimH. We used a mutant, E. coli AAEC191
(MG1655∆fim), lacking the entire locus for the purposes of this study (39). Many
experimental studies use mannose-BSA to provide for catch-bond formation. Here, we
used bovine ribonuclease B quenched with bovine serum albumin (BSA). In single
mutants lacking the fim locus, we observed significantly less initial adhesion than in any
other single mutant that we made.
Second, an important determinant of both initial adhesion and three-dimensional
structure formation in E. coli biofilms is the presence of the cell-surface appendage called
curli. Curli are important for initial adhesion to abiotic surfaces (41) and also for cell-cell
adhesion that leads to three-dimensional structure formation (42, 43). In E. coli, curli are
optimally expressed at 30ºC under low nutrient and low osmolarity conditions (44, 45),
3
which are similar to the conditions we use in our study. When csgA and csgD were
deleted from E. coli in previous studies that used similar conditions to our study, a sparse
monolayer was the best biofilm formed by the resultant strain (43). Two operons,
csgDEFG and csgAB, are responsible for the biosynthesis of curli monomers (CsgA) and
their export. We deleted both operons entirely from strain AAEC191 to create strain E.
coli MG1655∆fim, ∆csgC-csgG. Primers used were:
csgG-P1-fwd: 5’TCAGGATTCCGGTGGAACCGACATATGGCGGTATTTCACCAGAATGTCATGT
GTAGGCTGGAGCTGCTTC
and csgC-P2-rev: 5’TTAAGACTTTTCTGAAGAGGGCGGCCATTGTTGTGATAAATGAAGTGACTGC
ATATGAATATCCTCCTTA;
A third factor, implicated in three-dimensional structure formation of E. coli
biofilms but not in initial adhesion, is the presence of colanic acid (CA) (43). CA is an
excreted polysaccharide that surrounds cells in biofilms and creates space between them
which presumably allows for diffusion of nutrients and wastes, for communication
between cells, and for growth. CA is a constituent of the “slime” that is commonly
mentioned in macroscopic observations of biofilms. It is not clear whether E. coli
MG1655 produces CA when it is sessile (43), but CA is important in determining the
initial three-dimensional structure of MG1655 biofilms while cells are actively growing
and dividing (43, 46). 19 genes in the wca locus are responsible for CA production and
secretion. Genes encoding CA are most highly expressed at temperatures below 25ºC
and in minimal medium with an accessible carbon source (47). These conditions are
approximately those in our study so we deleted the entire locus wcaL–wza to create strain
E. coli MG1655∆fim, ∆wcaL–wza, ∆csgC-csgG. Primers used were:
4
wza-P1-fwd: 5’ATGATGAAATCCAAAATGAAATTGATGCCATTATTGGTGTCAGTAACCTTGTG
TAGGCTGGAGCTGCTTC
and wcaL-P2-rev: 5’CTATAAAGCCTGCAGCAAGCTGGCGAGTTCTCGATTGATCACCTGCTGGTCAT
ATGAATATCCTCCTTA
S1.3 Constructing the engineered plasmid in the blue strain
The engineered plasmid in the blue population was constructed from pFNK202 which
encodes constitutive expression of RhlR and RhlR-dependent expression of GFP (48).
We initially simply replaced the GFP gene with the dapD gene. Proper function of the
symbiotic consortium requires that very little DapD be present in blue cells in the absence
of the yellow population, while the presence of yellow cells should restore biological
levels of DapD to blue cells. However, minor expression (promoter “leakage”) of DapD
allows the blue population to begin forming a sparse biofilm without C4HSL so that the
symbiotic consortium can gain a foothold in the environment. We obtained an adequate
basal expression level of dapD, with wild-type levels of biofilm formation in the presence
of 10 µM C4HSL, by placing dapD under control of the RhlR-activated promoter
p(qsc119) with ribosome binding site (RBS) H, and attaching an LVA degradation tag to
DapD. We tried various other permutations of this arrangement, including a variety of
RBS strengths, and expressing dapD with and without the LVA tag, but the combination
we chose yielded optimal behavior. The additional presence of plasmid pMP4641 in this
strain confers constitutive expression of eCFP (49).
5
S1.4 Constructing the engineered plasmid in the yellow strain
The yellow population contains an engineered plasmid encoding strong constitutive
expression of the C4HSL synthase, RhlI. This engineered plasmid was constructed from
pFNK102, which encodes constitutive expression of RhlI (48). Yellow cells must
synthesize enough C4HSL to activate RhlR, and thereby to upregulate dapD expression,
in the blue population early in the lifespan of the consortium so that the blue population
does not die. The strong constitutive promoter p(lacIq), even coupled with the strong
ribosome binding site RBSII, did not provide adequate C4HSL production to enable
optimal function of the symbiotic consortium. We therefore replaced p(lacIq) with the
stronger constitutive promoter pJ23100, and combined this with RBSII, to yield enough
C4HSL in the biofilm environment to activate the symbiotic function. This strain also
contains plasmid pMP4658, yielding constitutive expression of eYFP (49).
6
References
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
Richaud C, Richaud F, Martin C, Haziza C, Patte JC (1984) Regulation of
expression and nucleotide sequence of the escherichia coli dapd gene. J Biol
Chem 259, 14824-8.
Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in
escherichia coli k-12 using pcr products. Proc Natl Acad Sci U S A 97, 6640-5.
Cherepanov PP, Wackernagel W (1995) Gene disruption in escherichia coli: Tcr
and kmr cassettes with the option of flp-catalyzed excision of the antibioticresistance determinant. Gene 158, 9-14.
Blomfield IC, McClain MS, Eisenstein BI (1991) Type 1 fimbriae mutants of
escherichia coli k12: Characterization of recognized afimbriate strains and
construction of new fim deletion mutants. Mol Microbiol 5, 1439-45.
Thomas W, et al. (2006) Catch-bond model derived from allostery explains forceactivated bacterial adhesion. Biophys J 90, 753-64.
Prigent-Combaret C, et al. (2001) Complex regulatory network controls initial
adhesion and biofilm formation in escherichia coli via regulation of the csgd gene.
J Bacteriol 183, 7213-23.
Vidal O, et al. (1998) Isolation of an escherichia coli k-12 mutant strain able to
form biofilms on inert surfaces: Involvement of a new ompr allele that increases
curli expression. J Bacteriol 180, 2442-9.
Prigent-Combaret C, et al. (2000) Developmental pathway for biofilm formation
in curli-producing escherichia coli strains: Role of flagella, curli and colanic acid.
Environ Microbiol 2, 450-64.
Olsen A, Jonsson A, Normark S (1989) Fibronectin binding mediated by a novel
class of surface organelles on escherichia coli. Nature 338, 652-5.
Olsen A, Arnqvist A, Hammar M, Sukupolvi S, Normark S (1993) The rpos
sigma factor relieves h-ns-mediated transcriptional repression of csga, the subunit
gene of fibronectin-binding curli in escherichia coli. Mol Microbiol 7, 523-36.
Xavier JB, Foster KR (2007) Cooperation and conflict in microbial biofilms. Proc
Natl Acad Sci U S A 104, 876-81.
Markovitz A (1977) in Surface carbohydrates of the prokaryotic cell, ed.
Sutherland IW (Academic Press, New York), Vol. 1, pp. 415-462.
Brenner K, Karig DK, Weiss R, Arnold FH (2007) Engineered bidirectional
communication mediates a consensus in a microbial biofilm consortium. Proc
Natl Acad Sci U S A 104, 17300-4.
Bloemberg GV, Wijfjes AH, Lamers GE, Stuurman N, Lugtenberg BJ (2000)
Simultaneous imaging of pseudomonas fluorescens wcs365 populations
expressing three different autofluorescent proteins in the rhizosphere: New
perspectives for studying microbial communities. Mol Plant Microbe Interact 13,
1170-6.