Jeong et al.
Supplemental Data
HIF-1α immunoassay
Methods for specimen collection and processing to preserve HIF-1α in 18-gauge tumor needle
biopsies have been validated and a modified version of the DUOSet IC ELISA Kit from R&D
Systems was validated to quantitatively measure HIF-1α levels in human tissue biopsy [1].
Core needle biopsies (18-gauge) were immediately dry flash frozen and stored at -80°C. At the
time of the assay, samples were thawed in 250 µL nitrogen-purged extraction buffer containing
protease inhibitors (Roche Applied Science), phenylmethylsulfonyl fluoride (Sigma-Aldrich),
and the prolyl hydroxylase inhibitor 2-hydroxyglutarate (3B Scientific Corporation), which
stabilizes HIF-1 protein. Cells were lysed using Precellys 2.8 mm ceramic bead tubes and the
Precellys24 tissue homogenizer; protein content was determined using the BCA protein assay kit
(Thermo Scientific). A minimum lysate concentration of 0.5µg/µL was needed to proceed with
the assay. For the immunoassay, 100 µL of DUOSet capture antibody at a concentration of 4
µg/mL (Lot# KQE0411012) in 1x PBS was added to each well of a 96-well white microtiter
plate and incubated at 2°C-8°C for 16±1 h. Wells were blocked with 300 µL Reagent Diluent
(1x PBS, 0.05% Tween 20, 5% bovine serum albumin) at 24°C for 1-2 h. DUOSet HIF-1α
standard was serially diluted in Reagent Diluent to a range of 7.8 to 1000pg HIF-1α/mL and
served as standard controls. HIF-1α standards or controls were loaded in 100 µL total volume
with Reagent Diluent; clinical samples were loaded in triplicate at 5, 7.5, and 10 µL cell extract
diluted in Reagent Diluent per well onto each plate and incubated at 2°C-8°C for 16±1 h. Next,
100 µL/well of DUOSet HIF-1α detection antibody (100 ng/mL, Lot# KKR0311012) in Reagent
Diluent was added and incubated at 24°C for 2 h. Then 100 µL/well DUOSet streptavidinhorseradish peroxidase conjugate (KPL, Gaithersburg, MD) at a final concentration of 5 µg/mL
Jeong et al.
(1:200, Lot# 1260918) in Reagent Diluent was added and incubated at 24°C for 30 min. Finally,
100 µL/well of room temperature LumiGLO Chemiluminescent Substrate (KPL) was added and
the plate immediately read on a Tecan Infinite M200 plate reader (Tecan Systems, San Jose,
CA). Relative light unit values were plotted using a HIF-1α analysis template to generate
standard curves. Average HIF-1α level, standard deviation, and CV for each tumor extract were
determined from the HIF-1α standard curve. Final HIF-1α readout for each sample was reported
as pg HIF-1α per 1 μg total protein using the HIF-1α standard curve.
RNA extraction and real-time PCR analysis
After collection, tumor biopsy samples were submerged in RNAlater RNA Stabilization Reagent
(Qiagen), kept at 4°C for 24 hours, and then stored at -20°C. Samples were subsequently
disrupted and homogenized in RNA Lysis Buffer (RNeasy Mini Kit, Qiagen) using FastPrep
(Lysing Matrix D columns, MP Biomedicals). Total RNA was extracted according to the
manufacturer's procedure. Genomic DNA was digested using RNase-Free DNAse Set (Qiagen)
during RNA extraction. RNA integrity was evaluated using RNA 6000 Nano Assay in an
Agilent 2100 Bioanalyzer (Agilent Technologies). RT-PCR was carried out using an RT-PCR
kit (PE Biosystems) according to the manufacturer's procedure. Expression of VEGF, GLUT-1,
HK2, PDK1 and CA9 were assessed by real-time PCR using a 7500 Real-Time PCR System
(Applied Biosystems). Typically, 5 ng of reverse-transcribed cDNA per sample was used to
conduct real-time PCR in triplicate samples. Primers and probes used are listed below in
Supplementary Table S1. Detection of 18S rRNA, used as internal control, was carried out using
premixed reagents from Applied Biosystems. Detection of VEGF and 18S rRNA was carried
out using TaqMan Universal PCR Master Mix (Applied Biosystems), whereas GLUT-1, HK2,
Jeong et al.
PDK1 and CA9 detection was carried out using Sybr Green PCR Master Mix (Applied
Biosystems). Values are expressed as percent change relative to pretreatment samples for each
patient.
HIF-1α and B2M mRNA copy numbers in tumor tissues were determined in comparison with
standard curves constructed using 30, 3x102, 3x103, 3x104 and 3x105 copies of expression
plasmids molecules. HIF-1α mRNA copy numbers were normalized to mRNA copy numbers of
the house keeping gene B2M and expressed as HIF-1α/B2M copy number. A pShuttle-HIF-1α
expression vector was generated by inserting human full-length wild type HIF-1α cDNA into
pShuttle (Clontech) while the B2M expression plasmid (pBJ1-hB2M) was obtain by Addgene
(plasmid 12099) [2].
DCE-MRI Technique
Imaging was performed using a 1.5-T MR system (Philips Achieva, The Best, The Netherlands)
with a dedicated receive-only 6-channel phased array coil. First, the diagnostic T2-weighted
images, that were used to locate the target tumor, were obtained using (TR/TE) 4600/100 msec, a
section thickness of 6 mm, 400 mm field of view, and a matrix of 320 x 320. Next, the
unenhanced T1-weighted images, used to determine the tissue T1 map, were acquired with a
three-dimensional spoiled gradient- echo sequence by using (TR/TE) 9/3.6 msec, a 5° flip angle,
5 mm-thick sections, 400 mm field of view, and a matrix of 256x256. Finally, DCE-MR images
were obtained with a three-dimensional spoiled gradient- echo sequence using (TR/TE)
9/3.6msec, a 15° flip angle, 5-mm-thick sections through the entire target lesion, 400 mm field of
view, an acquisition time of 30 seconds per data set, and a matrix of 256 x 256. After three
baseline unenhanced image acquisitions, an automatic injector (Medrad Spectris, Indianola, PA)
Jeong et al.
was used to intravenously infuse gadopentetate dimeglumine (Magnevist; Bayer Healthcare
Pharmaceuticals, Wayne, NJ) at 0.3 mL/sec, for a total of 0.1 mmol per kilogram of body weight
(typically 15–20 mL), followed by a 50-mL normal saline flush. Continuous 30-second imaging
data sets were obtained before, during, and after administration of the contrast medium for a total
of 8 minutes to result in 23 repeated data sets. Patients were asked to hold their breath during
MR image acquisitions.
DCE-MRI Analysis
Data from DCE-MRI were analyzed using a computer-based 2-compartment model based on the
Kety model, which has also been termed the general kinetic model (GKM) [3]. GKM
incorporates an arterial input function derived from aortic measurements and a T1 map for
converting signal intensity to gadolinium concentration. It is based on a 2-compartment model
that assumes that the vascular space is in rapid equilibrium with the extravascular, extracellular
space and further assumes a rapid water exchange between intra- and extracellular water. GKM
analysis was performed in an IDL-based (Interactive Data Language; Research Systems Inc.,
Boulder, CO) research tool (Cine Tool, GE Healthcare). Region-of-interest measurements were
obtained from one selected target lesion in each patient. Two parameters derived from the curve
fitting GKM algorithm were used to perform the quantitative analysis: Ktrans, the forward contrast
transfer rate, kep, and the reverse contrast transfer rate.
References
1.
Park SR, Kinders RJ, Khin S, Hollingshead M, Parchment RE, Tomaszewski JE,
Doroshow JH (2012)Validation and fitness testing of a quantitative immunoassay for HIF-1
alpha in biopsy specimens. Cancer Res 72: 3616
Jeong et al.
2.
Olson R, Huey-Tubman KE, Dulac C, Bjorkman PJ (2005) Structure of a pheromone
receptor-associated MHC molecule with an open and empty groove. PLoS Biol 3: e257
3.
Kety SS (1951) The theory and applications of the exchange of inert gas at the lungs and
tissues. Pharmacol Rev 3: 1-41
Jeong et al.
Supplemental Table S1. RT-PCR primers.
Primer name
Sequence
HIF-1a forward
CCAGTTACGTTCCTTCGATCAGT
HIF-1a reverse
TTTGAGGACTTGCGCTTTCA
B2M forward
GACTTGTCTTTCAGCAAGGA
B2M reverse
ACAAAGTCACATGGTTCACA
VEGF forward
TACCTCCACCATGCCAAGTG
VEGF reverse
ATGATTCTGCCCTCCTCCTTC
GLUT-1 forward
GATCCTGGGCCGCTTCAT
GLUT-1 reverse
ACATGGGCACGAAGCCTG
PDK1 forward
CAAGAATGCAATGAGAGCCACTA
PDK1 reverse
CCAGCGTGACATGAACTTGAA
CAIX forward
ACATGGGCACGAAGCCTG
CAIX reverse
AACTGCTCATAGGCACTGTTTTCTT
Jeong et al.
Supplemental Table S2. HIF target genes
Gene symbol Gene name
Function
VEGF
vascular endothelial
growth factor A
Growth factor active in angiogenesis, vasculogenesis
and endothelial cell growth
PDK1
pyruvate
dehydrogenase kinase,
isozyme 1
Inhibits the mitochondrial pyruvate dehydrogenase
complex, thus contributing to the regulation of
glucose metabolism
CA9 (CAIX)
carbonic anhydrase IX
Catalyzes the reversible hydration of carbon dioxide
GLUT1
solute carrier family 2
(facilitated glucose
transporter), member 1
Facilitative glucose transporter