Single Primer ("Semi-Random") PCR
July 26, 2000 ECK
Description
Single primer PCR allows amplification from known to unknown
regions in chromosomes, phage, plasmids, large PCR products and
other sources of DNA.
At sufficiently low stringency, any primer will misprime while
continuing to bind specifically to its intended site. Conditions can
usually be found allowing mispriming sufficiently close (<3.5 kb)
to the correct site to permit amplification anchored at the same.
Reamplification with a nested primer and the original outside
primer generates a product with unique ends. The resulting size
shift can be used to diagnose the correct product, which can then
be sequenced from either end.
Two methods are presented. The "Short" method can be done
quickly and works about 80% of the time in our lab for any given
primer Po (see figure below) It has been adapted from Hermann et
al (1). The "Long" method, developed in our laboratory (2),
requires more time but will often work when the short method
fails. Another advantage of the long method is that the product has
unique ends, allowing convergent sequencing.
When amplifying out of inverted repeats at the ends of certain
elements such as Tn10 or Tn5, gel purify bands before sequencing.
If you try to sequence the crude PCR reaction, you will get
superimposed sequences coming out of both ends.
In our lab, PCR is always done in an Air ThermoCycler (Idaho
Technologies, PO Box 50819, Idaho Falls, ID 83402), which
ramps quickly, allowing short dwell times during denaturation and
annealing. This enables rapid and stringent polymerization, while
minimizing enzyme aging and template hydrolysis. We have not
tested the protocal on other machines.
In an appendix at the end, I present some primers which have
worked well in our lab when sequencing out of common insertion
sequences.
Protocol
Single primer PCR works best when when there are nested primers
Po and Pn with sites in the known region:
1. Short Method
When this method fails, try varying the annealing temperature in
the second cycling regime. If that doesn't work, try changing
primers. If problems persist, switch to the long method.
Do the following PCR reaction:
15 µL H2O
3 µL 10xM-PCRB
3 µL 4 dNTPs @ 2 mM each
3
µL Po @ 5 µM
3 µL template diluted to about 1 ng/µL
3 µL
"T/TS" @ 0.4 u Taq/µL
--------
30 µL
Cycle as follows:
30"x94°C
20 cycles 0"x94°C 0"x55°C 1'x72° S=9
30 cycles
0"x94°C 0"x40°C 1'x72° S=6
30 cycles 0"x94°C 0"x55°C 1'x72°
S=9
Clean up:
Add 1 µL ExoI nuclease @ 1 u/µL
1 hr x 37°
Purify using
Qiaquick (or related) technology, elute in 30 µL TE
Check 3 µL
on 1% agarose gel
Sequence with primer Pn
2. Long Method
Stringency optimization is done with Po, and reamplification using
a biased ratio of Po and Pn.
Make 3 reactions with varying [Mg++]:
15 µL H2O
3 µL 10x H, M or L-PCRB
3 µL 4 dNTPs @ 2 mM
each
3 µL Po @ 5 µM
3 µL template diluted to about 1
ng/µL
3 µL "T/TS" @ 0.4 u Taq/µL
--------
30 µL
Distribute 3 10 µL aliquots of each mix into capillaries and discard
remainder. Load sets of 3 capillaries, one from each mix,
consecutively into the same machine with the annealing
temperature ("Ta") set at 40, 45 and 50°, respectively.
Cycle as follows:
30"x94°C 20 cycles 0"x94°C 0"x55°C 1'x72° S=9
30 cycles
0"x94°C 0"xTa 1'x72° S=6
30 cycles 0"x94°C 0"x55°C 1'x72°
S=9
Load a 0.8% agarose gel according to the following pattern:
Reactions arrayed in this fashion have roughly increasing
stringency from left to right.
Find the highest stringency at which distinct bands are visible.
Usually, all such bands are anchored at the specific site
corresponding to Po. This is especially true if there are only one or
two, the situation we wish.
Isolate DNA. We generally core the band with a yellow tip, and
soak it overnight at 4° in a small amount of TE or H2. The
supernatant provides the template for reamplification.
It is also useful to reamplify the unfractionated products of the first
amplification, after first removing primers by Qiaquick, Wizard, or
similar methodology. Running the first and second amplification
products side by side will reveal correctly anchored bands, as they
will be shifted with respect to parental bands.
Reamplification
40 µL H2O
10 µL 10x M-PCRB
10 µL 4 dNTPs @ 2 mM
each
10 µL Pn primer @ 5 µM
10 µL Po primer @ 0.2 µM
10
µL DNA from part 1
10 µL "T/TS" @ 0.4 u Taq/µL
--------
100 µL
Load glass capillaries and amplify:
30"x94°C
30-40 cycles 0"x94°C 0"x55° 30" x 72°
5' x 72°
I have assumed typical values for Ta and extension time. These
may be modified as required by Pn and product size. I generally let
Ta equal 10° less than the primer Tm. 15-30" is sufficient for
products up to 1 kb in the AirCycler.
Electrophorese a 5 µL aliquot as before. Because the
reamplification was done with a 25:1 ratio of Pn to Po, the smaller
band should dominate, and may be the only one visible. If the
contaminant band is not present or has a yield only a small fraction
of that of the smaller band, then the remaining 95 µL of product
can be cleaned up directly using a Wizard PCR purification.
Otherwise, run the entire reaction on an agarose gel and purify
DNA from the appropriate band.
The prep is now ready to be sequenced. Pn will prime from the
known end, and Po from the unknown end.
Materials
1. 10x H, M or L-PCRB
500 mM Tris, pH 8.3
2.5 mg/mL BSA
MgCl2 to give 30, 20 or
10 mM, respectively
5% Ficoll
5 mM cresol red
2. T/TS
10.5 µL EDB
1 µL Taq Polymerase (Promega) @ 5 u/µL
1 µL
TaqStart antibody (CloneTech) as delivered
3. EDB
2.5 mg/ml bovine serum albumin in 10 mM Tris, pH 8.3
References
1. S.R.J.A.M. Hermann, S. O'Neill, T.T. Tsao, R.M. Harding &
J.L. Dale "Single primer amplification of flanking sequences"
Biotechniques 29, 1176-1180 (2000)
2. E.C. Kofoid, C. Rappleye, I. Stojiljkovic & J. Roth, "The 17gene ethanolamine (eut) operon of Salmonella typhimurium
encodes five homologues of carboxysome shell proteins" J.
Bacteriol. 181, 5317-5329 (1999)
Appendix -- Some Useful Primers
Primer common names are given first and should not be
overinterpreted. Database names are in parentheses, followed by a
comment. Sequences are written 5' to 3'. Each primer extends out
of its associated cassette by the shortest possible route (that is, it
emanates out of -- not into -- the cassette).
1. Tn10dTet core and derivatives
Po: TN10L (TP633) Binds just after tetA
terminator.
ACCAACCATTTGTTAAATCAGTTTTTGTTGTG
A
Po: TN10R (TP632) Binds just after tetR
terminator.
CAGTGATCCATTGCTGTTGACAAAGGGAATC
Pn: Any appropriate IS10 primer below.
2. IS10 and most TN10 derivatives
Po: F1284 (TP89) 38 bp from end; will not work in TPOPs;
CAAGATGTGTATCTACCTTAAC
Po or Pn: IS10R2
(TP134) 27 bp from end; right side of TPOPs only;
CAAGATGTGTATCCACCTTAACTTAATGATTTT
Pn:
IS10R4 (TP134) 4 bp from end; any Tn10 derivative, including
TPOPs;
AACTTAATGATTTTGATCAAAATCATTAGGGGATTCA
3. MudJ and relatives
Po: R86 (TP251) 61 bp before left end.
GCAAGCCCCACCAAATCTAATCCCA
Pn: R54 (TP240)
36 bp before left end. CCGAATAATCCAATGTCC
Po: F33
(TP81) 9 bp from end; extremely difficult PCR, because of large
stem-loop; the first 5 cycles should each be preceded by a 5" hold
at 94°C instead of the normal zero second holds; statistically, half
the bands will be products extending into the mud element, not
out.
GAAACGCTTTCGCGTTTTTCGTGCG
Pn: F20 (TP79)
Exactly at end.
GTTTTTCGTGCGCCGCTTC
4. Tn5-derived chloramphenicol resistance cassette (found in Mudcam and Tn10d-cam)
Po: CMR2 (TP699) 158 bp prior to gene facing
upstream.
CTTCCCGGTATCAACAGGGACA
Pn: CMR1
(TP698) 214 bp prior to gene facing
upstream.
GTCACAGGTATTTATTCGGCGCA
Po: CKO3
(TP45) 154 bp past gene facing
downstream.
AGGGCAGGGTCGTTAAATAGC
Pn: CMR3
(TP700) 223 bp past gene facing
downstream.
AGTGTGACCGTGTGCTTCTCAA