Supplementary section 1 PCR and Sequencing conditions PCR reactions were run in 25 l reactions with 0.3 l of each primer using the Qiagen Multiplex PCR kit (Qiagen). Samples were subjected to initial denaturation at 95C for 15 min, 38 cycles at 94C for 45 s, annealing at 60C for 90 s, and elongation at 72C for 90 s, followed by a final elongation step for 10 min at 72C. The PCR product was enzymatically treated with ExoSAP-IT (USB, Cleveland, OH, USA). Forward sequence primer was identical to PCR primer, reverse sequencing primer were different (see supplementary table 2),all samples were sequenced in both directions utilizing the BigDye Terminator Sequencing Kit, version 1.1. The sequence reactions were analyzed on an ABI Prism 3100 genetic analyzer with Sequencing Analysis software, version 3.7. Primer sequences for the amplification and sequencing of KRAS exon 2 Gene and exon Forward primer Reverse Primer KRAS GTGTGACATGTTCTAATATAGTCA GAATGGTCCTGCCCAGTAA exon 2 GTCCTGCACCAGTAATATGC KRAS exon 2 seq Size of PCR Annealing temperature product (°C) (bp) 218 60 Primer sequences for the amplification and sequencing of PIK3CA exon 9 and Gene and exon Forward primer Reverse Primer PIK3CA Exon 9 GGGAAAAATATGACAAAGAAAGC CTGAGATCAGCCAAATTCAGTT PIK3CA Exon 9 seq PIK3CA Exon 20 PIK3CA Exon 20 seq GGAAAAATATGACAAAGAAAGCTTATAAG ACAGAGAATCTCCATTTTAGCAC GCTCCAAACTGACCAAACTGTTC TGGAATCCAGAGTGAGCTTTC CTCAATGATGCTTGGCTCTG CCTGCTGAGAGTTATTAACAGTGC Size of PCR Annealing product (bp) 279 (°C) 349 temperature 60 60