SUPPLEMENT: Protocols Used to Amplify DNA from Herbarium Accessions
Prior to DNA extraction, countertops and equipment were thoroughly cleaned with
bleach. Dedicated pipetters and filter tips were used to process samples. An extraction
blank (a tube with no fungal material) was included in every extraction, and carried
through to PCR.
For each extraction, approximately 100-200 mg of dried mushroom material (usually gill
or cap tissue) was removed from an herbarium specimen using a sterile forceps. Each
sample was placed in a 2 ml screw-cap tube containing 3-5 3 mm glass beads and
samples were macerated with a Mini-BeadBeater-8 (BioSpec Products, Inc.) for 30
seconds at 3/4 speed. After maceration 600-800 µl of CTAB buffer (2% CTAB, 1%
PVP, 100 mM Tris-HCl pH 8.0, 20 mM EDTA, 1.4 M NaCl) was added to each tube, and
the samples incubated for one to two hours at 60˚C. Samples were then extracted twice
with an equal volume of chloroform:isoamyl alcohol (24:1), shaken for 10 minutes and
centrifuged at 13,200 rpm for 10 minutes. The supernatant of each sample was
transferred to a new tube and then two volumes of 100% ethanol were added. Samples
were precipitated at -20˚C for 20 minutes, and then centrifuged for 15 minutes. After
pouring off the ethanol, samples were briefly respun, and the remaining ethanol was
removed with a pipette. The samples were resuspended in 500 µl TE0.1 buffer (0.5 mM
Tris, 0.1 mM EDTA) and 20 µl 5M NaCl. Two volumes of 100% ice-cold ethanol were
added and the DNA was precipitated for one hour at -20˚C. After freezing, the samples
were centrifuged for 15 minutes, ethanol poured off, and samples washed once again with
75% ethanol. Samples were centrifuged for 10 minutes, and the ethanol was removed by
pipetting. Finally, the tubes were laid on their side on a Kimwipe to allow the remaining
ethanol to evaporate. The samples were then resuspended in 200 µl of TE0.1. If the
extraction remained darkly colored, or if initial PCR reactions were unsuccessful, an
aliquot of 30-50 µl was further cleaned using the Qiagen Qiaquick PCR cleanup kit
(Qiagen Inc., Germantown, MD), following the instructions provided by the
manufacturer. To elute the DNA, 50 µl of TE0.1 were added to the Qiaquick spin columns
and incubated at room temperature for 20 minutes, and then centrifuged for one minute at
13,000 rpm.
To confirm the identity of herbarium specimens a 330 bp portion of the internal
transcribed spacer region (ITS1) was amplified and sequenced using the fungal-specific
primers ITS1-F (Gardes and Bruns 1993) and ITS2 (White et al. 1990). PCR reactions
contained 2.5 µl of 10X PCR buffer (containing 15 mM MgCl2), 2 µl of 2.5 mM each of
all four dNTPs, 2.5 µl of 1 mg/ml Bovine Serum Albumen (BSA), 1 µl of each primer
(10 µM), and 0.1 µl of Qiagen taq (5 U/µl); water was used to bring reactions to a final
volume of 25 µl. For problematic sequences 5 µl of Betaine and additional MgCl2 were
added. PCR reactions were amplified in a BioRad iCycler with the following parameters:
5 minutes at 95˚C, followed by 36-40 cycles of 35 seconds at 95˚C, 55 seconds at 55˚C,
and 45 seconds at 72˚C, with a final elongation of 7 minutes at 72˚C. For older
specimens for which this initial amplification was not successful, we assumed the DNA
to be more degraded (and in shorter fragments), and so internal primers were based on
sequences of Amanita Section Phalloideae and designed to amplify a shorter 200 bp
section of ITS1 in combination with either ITS1F (ITSphl1R:
ATGGCATAGACACCCAGAT), or ITS2 (ITSphl2F:
GTCATTACCAATTCCACCTGT). The PCR reactions were identical to those described
above, but we used the following cycling parameters: 5 minutes at 95˚C, followed by 36
cycles of 95˚C for 30 seconds, 48˚C for 30 seconds, and 72˚C for 30 seconds, with a final
elongation of 7 minutes at 72˚C. All PCR products were purified using the Qiagen PCR
purification kit, and sequenced at the Dana-Farber/Harvard Cancer Center DNA
Resource Core (Boston, MA). Resulting sequences were edited using Sequencher v. 4.6
(Gene Codes Corporation, Ann Arbor, MI), and aligned with sequences of A. phalloides
as well as other Amanita species using MacClade v. 4.05 (Maddison and Maddison
2002).
LITERATURE

Gardes M, Bruns TD (1993) ITS primers with enhanced specificity for
basidiomycetes – application to the identification of mycorrhizae and rusts.
Molecular Ecology, 2, 113-118.

Maddison D, Maddison W (2002) MacClade. Sunderland: Sinauer Associates.

White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: A Guide to
Methods and Applications (eds. Innis MA, Gelfand DH, Sninsky JJ, White TJ)
pp. 315-322. Academic Press, Inc., New York.