Supplemental Data to Kapp 2014
Material and Methods
Melting curve - Analysis was carried out using an Applied Biosystems 7500 Real-Time PCR
System with 400 ng DNA/50 µl reaction in 10 mM Tris-HCl pH 8.3, 50 mM KCl, 3 mM MgCl2 in the
presence of 1.4x Sybr®Green I (Invitrogen) with the program Isothermal Dissociation starting at 40°C,
and then raising the temperature with 1K/min up to 99°C.
Cell isolation - Monocytes were removed from PBMCs using the CD14 MicroBead Kit, (Miltenyi
Biotec).
Figure Legends
Fig. S1. Thermal Dissociation of dSLIM® and educt ODN. dSLIM® (filled circles) and educt ODN
(eODN; open circles) were slowly heated up. Plotted are the differential increments of Sybr®Green
fluorescence measured during temperature elevation.
dSLIM® comprises a rigid double-stranded stem of DNA that disassembles not below 83°C. In
contrast, the educt oligonucleotide (eODN) for construction of dSLIM® forms a hairpin structure with
a stem length less than half the stem length of dSLIM®, and exhibits a melting temperature of
approximately 70°C. Due to predicted weak intra- and inter-loop base pairings at temperatures lower
than the melting point, the plotted increments of Sybr®Green binding to dSLIM® show constant
melting events starting from 40°C, with significant loss of Sybr®Green binding seen when the doublestranded stem disassembles at the melting temperature.
Fig. S2: Stability against exonuclease activity. DNA oligonucleotides without, partial or complete
PTO protection or dSLIM were digested with 0,5 U T7 DNA polymerase per µg DNA for 10 min at 37°C
in the absence of didesoxynucleotidetriphosphates. Due to different staining intensities according to
oligonucleotide length, composition and conformation, different amounts of incubated DNA were
separated over a 24% (19:1 crosslinked) polyacrylamide gel supplemented with 7 M urea in a Tris1
borate system. Shown are fluorescence images (excitation at 280 nm) of ethidiumbromide stained
gels after separation at 300 V. Samples: ODN2006/0 unprotected sequence of ODN2006, TCATTGGAAAACGTTCTTCGGGGCGTTCTT, 300 ng were used for digestion, 300 ng were loaded onto the gel as
non-digest control; ODN2006/1, terminally 1x PTO-protected sequence of ODN2006, TCGTCGTTTTGTCGTTTTGTCGT*T, 300 ng were digested and reaction was completely loaded onto the gel;
ODN2006/2, terminally 2x PTO-protected sequence of ODN2006, TCGTCGTTTTGTCGTTTTGTCG*T*T,
300 ng; ODN2006/3, terminally 3x PTO-protected sequence of ODN2006, TCGTCGTTTTGTCGTTTTGTC*G*T*T, 300 ng; ODN2006/4, terminally 4x PTO-protected sequence of ODN2006, TCGTCGTTTTGTCGTTTTGT*C*G*T*T, 300 ng; ODN2006, completely PTO-protected, 1000 ng;
L/0, unprotected
sequence of dSLIM loop, TCATTGGAAAACGTTCTTCGGGGCGTTCTT, 200 ng were used for digest as
well as control; L/1, terminally 1x PTO-protected sequence of dSLIM loop, TCATTGGAAAACGTTCTTCGGGGCGTTCT*T, 200 ng; L/2, terminally 2x PTO-protected sequence of dSLIM loop, TCATTGGAAAACGTTCTTCGGGGCGTTC*T*T, 200 ng; L/3, terminally 3x PTO-protected sequence of dSLIM loop, TCATTGGAAAACGTTCTTCGGGGCGTT*C*T*T, 200 ng; L/4, terminally 4x PTO-protected sequence of dSLIM
loop, TCATTGGAAAACGTTCTTCGGGGCGT*T*C*T*T, 200 ng; dSLIM, circular closed complete dSLIM
molecule, 70 ng for digest and control, each. * denotes a phosphothioate bond.
Due to its closed circular conformation, dSLIM migrates in denaturating PAGs much slower than
would be expected from a 116mer polynucleotide; on agarose gels dSLIM migrates like DNA 60-70
base pairs in length. Fully PTO-protected ODN2006 migrates slower than partially or non-protected
24-mer ODN of the same sequence.
Fig. S3: Cellular activation by non-CG dSLIM. PBMCs were incubated without (open circles), in the
presence of 3 µM dSLIM® (filled triangles up), or 3 µM non-CG dSLIM® (filled triangles down) for
48 h. The corresponding data of each donor are connected by lines; the seven donors for PBMC were
the same for all different activation markers depicted, except for pDC markers: frequencies of two of
the seven donors were too low for analysis and had been removed. Cells were stained with
2
antibodies against lineage and the indicated activation markers. Frequencies or MFI of activation
markers within the cell populations are shown (means are shown; *, P < 0.05; **, P < 0.01;
***, P < 0.001; NS – not significant; repeated measures ANOVA; Fisher’s LSD test).
Fig. S4. Cytokine secretion by non-CG dSLIM. PBMCs were incubated without (open circles), in the
presence of 3 µM dSLIM® (filled triangles up) or 3 µM non-CG dSLIM® (filled triangles down) for 48 h.
The corresponding data of each donor are connected by lines; the seven donors for PBMC were the
same for all 8 cytokines determined and also identical to the donors of Fig. S3. Cytokine levels in the
supernatants were determined by a bead-based multiplex immunoassay or ELISA (means are shown;
n = 7; *, P < 0.05; **, P < 0.01; ***, P < 0.001; non-parametric Friedman test; Dunn`s multiple
comparisons test, ; NS – not significant; NS – not significant in Friedman test, but ranked significant
[*, p < 0.05] in the Wilcoxon matched-pairs rank test). In contrast to Fig. S3 cytokine data were
analyzed by a non-parametric test due to the obviously non-Gaussian distribution of the majority of
data groups (only IP-10 release from those 7 donors seemed to be normal-distributed).
Fig. S5. Monocytes are the IP-10 secreting cell population in PBMCs. Cells were treated with dSLIM®
at a final concentration of 3 µM (filled symbols) or without dSLIM® (medium control – open symbols).
(a) Detection of the IP-10 producing cells. PBMCs were incubated with dSLIM® for 21 h; Brefeldin A
was added for the last 7h. Thereafter, cells were fixed, permeabilized, stained for CD14 (61D3,
eBioscience) and IP-10 (64D4/D6/G2, BD Biosciences), and analyzed by flow cytometry. Dot plots of
the PBMC gate are shown from a representative staining; the summary of all experiments is depicted
in the table. (b) Influence of monocytes on the cytokine secretion pattern of PBMCs. PBMCs (triangle
down) and monocyte-depleted PBMCs (circle) were treated with dSLIM® for 48 h. Cytokine levels in
the supernatants were determined by a bead-based multiplex immunoassay. Differences between
dSLIM®-treated PBMCs and medium control, as well as dSLIM®-treated PBMCs and dSLIM®-treated
3
monocyte-depleted PBMCs are significant for the indicated cytokines (means are shown; n = 4; *, P <
0.05; **, P < 0.01; repeated measures ANOVA; Fisher’s LSD test).
Removal of monocytes from PBMCs impeded IP-10 secretion (panel B). However, monocytedepleted PBMCs continued to release IFN-alpha upon dSLIM® activation, albeit at a reduced level
compared with non-depleted PBMCs, while IFN-gamma secretion from PBMCs was unaffected by the
presence or absence of monocytes in the PBMC suspension.
Fig. S6. ODN2006 shows some activity at low concentrations. PBMC were treated with dSLIM®
(filled bars) or ODN2006 (open bars) at the indicated final concentrations ranging from 0.01 to
3.2 µM. Cytokine levels in the supernatants were determined by a bead-based multiplex
immunoassay or ELISA. For each individual experiment and cytokine, the analyzed concentration was
normalized to the concentration secreted after stimulation with dSLIM® at a final concentration of
3.2 µM (IFN-gamma 54–614 pg/ml; IFN-alpha 34–1,782 pg/ml; IP-10 18,029-286,709 pg/ml). Means
and SEM resulting from the stated numbers of individual experiments are shown (IFN-alpha n = 10,
0.0 1µM n = 4; IFN-gamma n = 12, 0.01 µM n = 5; IP-10 n = 13, 0.01 µM n = 5).
4