Supplementary Information for " Lrs14 transcriptional regulators influence biofilm formation and cell motility of Crenarchaea" by Orell et al. Protein sequence analysis Similarity searches were conducted using BLASTP at the National Center for Biotechnology Information (NCBI). Multiple alignment of archaeal Lrs14-like and Lrp/AsnC protein sequences was constructed using the CLUSTALW program (Thompson et al. 1994), followed by manual adjustment. Domain analysis on protein sequences was performed using SMART 4.0 (Letunic et al. 2004). Jpred3 was used for secondary structure prediction (Cole et al. 2008). Phylogenetic analyses were conducted using MEGA4 (Tamura et al. 2007). The evolutionary history was inferred using the Neighbor-Joining method (Saitou & Nei 1987). The bootstrap consensus tree inferred from 1000 replicates was taken to represent the evolutionary history of the analyzed taxa. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. The evolutionary distances were computed using the Poisson correction method (Zuckerkandl & Pauling 1965). All positions containing gaps and missing data were eliminated from the dataset (complete deletion option). Construction of plasmids for in-frame gene deletion and in-trans-complementation For the construction of the deletion mutant plasmids, the respective up- and down-stream flanking regions of saci0102, saci0446, and saci1242, respectively, were PCR amplified from S. acidocaldarius genomic DNA using primer pairs as listed in Table S1. The up- and downstream flanking DNA regions were joined by means of overlap extension PCR using the outward bound primer of the respective primer pair. The overlap extension PCR products were restricted with PstI and BamHI and subsequently ligated into the plasmid pSVA406, containing the pyrEF 1 cassette from S. solfataricus (Wagner et al. 2009). This ligation yielded deletion plasmids pSVA452, pSVA453 and pSVA2004 (see Table 1 for details). For overexpression of Saci0446 in S. acidocaldarius MW001, the saci0446 gene was cloned into the S. acidocaldarius expression vector pSVA1450, (Wagner and Albers, unpublished) which is based on pCmalLacS (Berkner et al. 2010) and allows for maltose inducible expression of proteins. saci0446 was first cloned into pMZ1 yielding pSVA2022, thereby adding 6 histidine residues to the N-terminus of saci0446, which originate from the multiple cloning site of pMZ1. pMZ1 contains an expression cassette for Sulfolobus species including a terminator region (Zolghadr et al. 2007). The saci0446 gene was then excised with the terminator region from pSVA2022 using NcoI/ EagI and ligated with pSVA1450. This construct was termed pSVA2026. A plasmid for the complementation of Saci0446 including its promoter DNA region was constructed in the expression plasmid pSVA1450. The saci0446 gene including its promoter region was, therefore, amplified using primer pair 4069/4070. The PCR product was restricted with SacII/EagI and ligated into pSVA1450 yielding plasmid pSVA2024. Plasmids pSVA2024 and pSVA2026 were methylated using the E. coli strain ER1821 as described by Wagner et al. (2012). Methylated plasmids were transformed into S. acidocaldarius cells as described previously (Wagner et al. 2012). Plasmid containing colonies were selected on gellan gum solidified Brock medium plates without uracil. Obtained colonies were grown in liquid Brock medium and used for the inoculation of biofilms. All constructs were sequenced to confirm their identity. The primer sequences are given in Table S1. Construction of chromosomal deletion mutants In frame marker-less deletion mutants were generated for genes saci0102, saci0446, and saci1242. To this end, methylated deletion mutant plasmids pSVA452, pSVA453 and 2 pSVA2004 were electroporated into MW001 as described by Wagner et al. (2012). Integrants were selected on uracil selective gelrite plates after 5 days of incubation at 75°C and subsequently subjected to 5-FOA (100 µg/ml) gelrite plates to allow the excision of the DNA region containing the target gene. In frame marker-less deletion mutants were confirmed by sequencing of PCR products that were obtained using primers binding at least 100 bp up and downstream of the respective primers used for the construction of the flanking regions for the deletion mutant plasmids. Gene disruptions by S. solfataricus pyrEF cassette exchange via homologous recombination were generated for saci0133, saci1219 and saci1223. To this end, 50 bp of the up and downstream regions of each target gene were added to the 5’ and 3’ ends of the pyrEF cassette via PCR. S. acidocaldarius MW001 cells were electroporated with ~300 ng of the corresponding PCR product. Transformed cells were selected on uracil selective gelrite plates after 5 days of incubation at 75 °C. Obtained colonies were transferred to liquid Brock medium. Deletion mutants were confirmed by sequencing of PCR products that were obtained using primers that bound at least 100 bp up and downstream of the target gene and one reverse and one forward primer annealing in the pyrEF cassette sequence, respectively. Western blotting Cultures for immunological analyses were grown in liquid Brock medium to reach an OD600 0.5 and harvested by centrifugation at 3400 x g. The pellet was resuspended in fresh medium without nutrient source. After 4 h, 0.001% tryptone was added to each culture and further incubated at 76 °C overnight. Cells were harvested and the pellet was resuspended in buffer containing 50 mM HEPES and 150 mM NaCl. Proteins were separated by SDS-PAGE according to the method of Laemmli (Laemmli, 1970) and transferred to a PVDF membrane (Roche) by semi-dry blotting. Polyclonal peptide antibodies against S. acidocaldarius anti-FlaB 3 were raised in rabbits (Eurogentec). Binding of the secondary antibody, the alkaline phosphatase goat anti-rabbit immunoglobulin G (Sigma) was detected by using the CDP-star chemiluminescent detection kit (Roche) according to the manufacturer’s instructions. Chemiluminescence was measured using the LAS-4000 Luminescent image analyzer (Fujifilm, Düsseldorf, Germany). Heterologous expression of saci0446 and protein purification To express N-terminal histidine tagged Saci0446 protein, saci0446 was amplified by PCR from genomic DNA of S. acidocaldarius DSM639 using primer (Table S1) and cloned into the pETDuet-1 vector system (Novagen), yielding plasmid pSVA2009. The constructed plasmid was verified by sequencing of both strands. Heterologous expression of recombinant Saci0446 was performed as reported previously (Ghosh et al. 2011), using E. coli BL21 (DE3)-RIL as expression host strain. For purification of the recombinant protein, the resulting E. coli crude extracts were diluted 1:1 with 50 mM HEPES, 300 mM KCl (pH 7.5) and subjected to a heat precipitation for 10 min at 70°C. After heat precipitation, the samples were cleared by centrifugation (60,000 x g for 30 min at 4°C). The supernatant was applied to a Ni2+-affinity column (Native IMAC) on the Profinia TM protein purification system (Bio-Rad Laboratories). Bound protein was eluted with elution buffer (50 mM HEPES, pH 8.0; 300 mM KCl; 250 mM imidazole). A final desalting step was incorporated during the Profinia purification protocol to wash the imidazole out of the protein sample. Fractions containing the recombinant protein (analyzed by SDS-PAGE and anti-his Western blotting) were pooled and concentrated via centrifugal concentrators (Amicon Ultra Centrifugal Filter 5000 MWCO, Millipore) using buffer A (50 mM NaH2PO4, pH 7.5; 100 mM NaCl). Protein samples were used for DNA-protein binding assays or stored at -20°C in presence of 10% glycerol. 4 DNA-protein binding assays and in gel footprinting experiments For protein-DNA interaction studies, 5’-end 32 P-labeled DNA fragments were generated by PCR-amplifying desired fragments with S. acidocaldarius genomic DNA as template and with two primers, one being labeled with [γ-32P]-ATP with T4 polynucleotide kinase. Following primer pairs were used: ep092/ep093 (promoter/operator (p/o) saci0446), ep094/ep095 (ORF saci0446), ep096/ep097 (p/o saci1178), ep098/ep099 (p/o saci1177), ep100/ep101 (p/o saci2314) and ep102/ep103 (p/o saci1908) (Table S1). Labeled probes were purified on a 6% acrylamide gel. Electrophoretic mobility shift assays (EMSAs) were conducted as described before (Peeters et al, 2007). Binding reaction mixtures were incubated at 37°C for 25 minutes in LrpB buffer and contained, besides different amounts of the protein, 7500 cpm of DNA and 25 mg ml-1 sonicated salmon sperm DNA as non-specific competitor. Gel electrophoresis was performed with 6% native acrylamide gels. EMSA autoradiographs were scanned and integrated densities of individual bands were measured with ImageJ (Abramoff et al., 2004). After subtraction of background densities, values were converted to the fraction of bound DNA. Subsequently, using the Prism 6 software (GraphPad) these data were plotted and fitted to a non-linear model with the Hill function, yielding for each fragment the apparent equilibrium dissociation constant (KD) and the Hill coefficient (n), which represents a measure of the binding cooperativity. For in gel footprinting with the 1,10-phenantroline-copper ((OP)2-Cu+) ion (Cu-OP) of the different DNA populations, an EMSA was performed with approximately 100,000 cpm DNA in each binding reaction before performing chemical footprinting, exposure to a X-ray sensitive film, excision and elution of different populations and analysis on a 8% denaturing acrylamide gel. The procedure was followed as described before (Peeters et al, 2004). Reference ladders were generated by chemical sequencing (Maxam & Gilbert, 1980). 5 References Berkner S, Wlodkowski A, Albers S V, Lipps G. (2010). Inducible and constitutive promoters for genetic systems in Sulfolobus acidocaldarius. Extremophiles 14: 249–259. Cole C, Barber JD, Barton GJ. (2008). The Jpred 3 secondary structure prediction server. Nucleic Acids Res 36: W197–W201. Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F. (1956). Colorimetric method for determination of sugars and related substances. Anal Chem 28: 350–356. Ghosh A, Hartung S, Van Der Does C, Tainer JA, Albers SV. (2011). Archaeal flagellar ATPase motor shows ATP-dependent hexameric assembly and activity stimula-tion by specific lipid binding. Biochem J 437: 43–52. Letunic I, Copley RR, Schmidt S, Ciccarelli FD, Doerks T, Schultz Jet al.(2004). SMART 4.0: towards genomic data integration. Nucleic Acids Res 32: D142–D144. Petersen GL. (1977). A simplification of the protein assay of Lowry which is more generally applicable. Anal Chem 83: 346–353. Saitou N, Nei M. (1987). The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425. Tamura K, Dudley J, Nei M, Kumar S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599. Thompson JD, Higgins DG, Gibson TJ. (1994). CLUSTALW: improving the sensitivity of of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680. Wagner M, Berkner S, Ajon M, Driessen AJ, Lipps G, Albers SV. (2009). Expanding and understanding the genetic toolbox of the hyperthermophilic genus Sulfolobus. Biochem Soc Trans 37: 97–101. Zuckerkandl E, Pauling L. (1965). In Bryson V, Vogel HJ(eds). Evolutionary divergence and convergence. In Evolving Genes and Proteins 97: pp 97–166. 6 7 Figure S1. Sequence analysis of archaeal Lrs14-like proteins. (A) Multiple alignments of archaeal Lrs14 proteins together with E. coli Lrp and S. solfataricus Ss-LrpB protein sequences. Residues conserved ≥ 90 % are shown by (:) and (.) represents residues sharing 50% of conservation. Secondary structure prediction for both Lrs14-like proteins and Lrp-like proteins are indicted above the alignment (α helixes: yellow cylinders, β sheets: green arrows). The six S. acidocaldarius homologous Lrs14-like proteins are shown in bold. The location of a putative HTH motif and the RAM domain are indicated above the alignment. Accession numbers and ORF numbers are indicated. Species abbreviations: S.so, Sulfolobus solfataricus; S.ac, Sulfolobus acidocaldarius; S.to, Sulfolobus tokodaii; Hsp, Halobacterium sp. NRC1; E.co, Escherichia coli. (B) The NJ distance tree was constructed using a subset of each archaeal Lrs14-like and Lrp-like proteins. The six S. acidocaldarius homologous Lrs14-like proteins are underlined and the corresponding ORF numbers are depicted. Accession numbers are indicated in parentheses. Bootstrap values, based on 1000 repetitions, are shown next to the branches. Bar, 10 % estimated divergence. 8 Figure S2. Expression profile of S. acidocaldarius MW001 lrs14 genes of biofilmassociated cell population versus planktonic cell population. After 3 day biofilm growth the supernatant of the Petri dishes containing the planktonic cells was carefully removed. The biofilm was washed with 50 mL of Brock media and consecutively harvested with a cell scraper. Total RNA was isolated from both cell samples. qRT-PCR analysis were performed using specific primers for each Lrs14 encoding ORF (shown underneath the plot). Relative transcript expression levels of each gene were normalized to the internal control gene secY. The values reflect the fold change in gene expression compared with cDNA prepared from biofilmassociated cell population versus planktonic cell population. The means and standard deviations of 3 biological replicates are shown. 9 Figure S3. Construction of Lrs14 deletion mutants. (A) PCRs were performed with reference strain MW001 and the respective in-frame lrs14 deletion mutant genomic DNA revealing a downshift of the corresponding DNA band of the mutant DNA. (B) PCR of the deletion mutant generated by insertion of the pyrEF selection cassette. One forward primer annealing up-stream of the target gene and one primer annealing within the pyrEF cassette sequence were used. This primer combination allows amplifications only when mutant DNA is used as a template. 10 Figure S4. Planktonic growth of S. acidocaldarius Lrs14 deletion mutant strains. Shaking cultured mutant strains were sampled at various time points to measure cell density atOD600. Reference strain MW001 (-◊-) and marker-less deletion mutants Δsaci1242 (-Δ-), Δsaci0446 (-○), Δsaci0102 (-□-). Wild type of pyrEF disrupted deletion mutants MW001+pyrEF(-♦-) and disrupted deletion mutants Δsaci0133 (-■-), Δsaci1219 (-▲-), Δsaci1223 (-●-). Each pointrepresents the mean of 3 biological replicas. 11 Figure S5. CLSM analysis of biofilm formed by S. acidocaldarius MW001pyrEF+ strain. Three days old biofilms were subjeted to CLSM. The blue channel is the DAPI-staining. The green channel represents the fluorescently labeld lectin ConA that binds to glucose and mannose residues. The lectin IB4 able to bind to α-galactosyl-residues is shown in yellow. The overlay image of all three channels is shown (left panel). DIC pictures (midle panel) were taken from the bottom layer of biofilms and converted into black/white (right panel) to calculate the surface coverage. Numbers represent the percentage of surface coverage. Scale bar = 20 µm. Figure S6. His-tagged Saci0446 protein purification. The elution fraction obtained from a Ni2+-column chromatography was analyzed on a SDS-PAGE and stained with Coomassie. Bars to the left side indicate molecular weights in kilo Daltons. Expected size of His-tagged saci0446 protein is 14.97 kDa. 12 Figure S7. Footprinting assays of Saci0446 binding to its own promoter. (A) In-gel’ Cu-OP footprinting analysis of binding of saci0446 to a promoter fragment of its own gene with the top strand labeled. In the upper part, the preceding EMSA is shown with indicating of the different free (F) and bound (B) populations as they were excised for further analysis. Protein concentrations are indicated in µM. In the lower part, the footprint autoradiograph is shown with indication of the C+T sequencing ladder, aligned to the footprint lanes, and the different populations. Protected and hyperreactive regions in the higher-order complex are indicated to the right of the autoradiograph with open and grey rectangles, respectively. (B) In gel Cu-OP footprinting analysis of binding of saci0446 to a promoter fragment of its own gene with the bottom strand labeled. Notations are the same as in panel B, except that an A+G ladder has been included and that ball-and-stick symbols indicate hyperreactivity positions observed in lower-order complexes. (C) saci0446 promoter sequence with summary of footprint results. The translational stop and start codon of saci0445 (CAA on top strand) and of saci0446 (ATG on top strand) have been highlighted in bold. The notation of protected and hyperreactive regions is the same as in panels B and C. 13 Explanation belonging to the footprinting assays: To identify potential recognition motifs, we performed in gel Cu-OP footprinting with the p/o saci0446 probe, which is bound by Saci0446 with one of the highest affinities (Fig. 7B). For the nucleoprotein complexes with the highest electrophoretic mobility and lowest binding stoichiometries, no obvious protection zones were observed. This result suggested that complex populations consists of complexes bound at different locations and that Saci0446 binds with a low sequence specificity, a conclusion that is corroborated by the fact that the number of electrophoretically distinct complexes is proportional to DNA fragment length (data not shown). The protected regions observed in the complexes with higher stoichiometry are not well delineated and did not lead to the identification of a recognition binding motif (Fig. 6B). Interestingly, a negative correlation exists between the AT level of the tested DNA sequence and the apparent KD (Pearson’s correlation coefficient r −0.8522 and R2 0.73), demonstrating that Saci0446 interacts with AT-rich sequences with a higher affinity. In the footprint experiment with the bottom strand labeled, two positions exhibited hyperreactivity in the lower-order complexes, demonstrating protein-induced deformations at these specific locations (Fig. 7B/D). In the higher-order complexes extensive hyperreactivity occurs, leading to higher cleavage efficiencies of longer DNA molecules. Based on these cleavage patterns, it is likely that considerable conformational changes occurred in the DNA upon cooperative binding of multiple Saci0446 molecules. A similar footprinting pattern was observed for p/o Saci1908 (data not shown). 14 Table S1. Oligonucleotides used in this study Primer no. 1004 sequence description 5‘-GGGCCATGGAACTCAGGGTGAAAACCTAC Forward primer for upstream region Δsaci0102 with ApaI restriction site 1007 5‘CAAGGGAATTACTGGGACATTTATCTCACAAATA AAGTTC 5‘GTGAGATAAATGTCCCAGTAATTCCCTTGACTTT TCCCC 5‘-GCGGGATCCGGTTTGCGTGCTATATTCAG 2413 2414 5‘-TTGGGCTACAGAGGGACTTC 5‘-TTTGTCCACGAGGACTAACG 1012 1019 5‘-GGGCCATGGTTCCGTCGGAAGTGTCAAC 5’GCATAATTCCTCTTCAATACTCATTTTAATCTCG CCTTTG 5’GAGTATTGAAGAGGAATTATGCAAAGAATTAAA CCAAG 1073 5’-GATGGATCCGTAGGCTCAGTGGCTTTAAC 2415 2416 5‘-GACGATACGCCTGTAGTTTG 5‘-ACTGAAGGGCGGTTTCTATC 2417 5‘-GTAGGGCCCCAGGCATGAGACCCAATACG 2418 5‘-GAACCAATGAGTTAATATATTCAATTTTTAAC 2419 5‘-ATTGAATATATTAACTCATTGGTTCTTGGCTG 2420 2421 2422 5‘-GATGGATCCCCTCTAGCAGGAAGTCTTTG 5‘-AGGGTATCTCGTTTCACCAG 5‘-TGCAGTTAAGGCAACTGTGG 5‘CACTTTTTTTAGTTAGCAAAAACAAGTAATATTC GGAGTGATACAAAATGTTTGAGCAGTTCTAG 5‘CTATAGTAATAAGAGGAGATAATGTTATCTTAGT GTCTCCTGTTTAAGACGACCGGCTATTTTTTCAC 5‘TTTACTTTTTAATGAAAAGATTTAAATATGAGTAT TTAAAATGAATTAATTTTGAGCAGTTCTAG 5‘ATTTGATGAAATAAATCCTAAACCTGTAATTAAT ATTTTCACAGGCTAAAGACCGGCTATTTTTTCAC 5‘CAGAAGAAGGAGGAAAAGCAAGAAGAAAGTAAA AGTTAGATACTTTAGTTTTTGAGCAGTTCTAG 5‘ATAAAAATCGAAGGTAAAGTTTTTTAATTTTTAAT AACTTTATATTGCTTGACCGGCTATTTTTTCAC 5‘-AGTAGCCTATGGTCTTTCTGAATC 5‘-TCAACTAATCCTGCATCTGAAAGC 1005 1006 1018 2497 2498 4043 4044 4055 4056 2488 2489 Reverse primer for upstream region Δsaci0102, overlapping region Forward primer for downstream region Δsaci0102, overlapping region Reverse primer for downstream region Δsaci0102 with BamHI Forward sequencing primer Δsaci0102 Reverse sequencing primer Δsaci0102 Forward primer for upstream region Δsaci0446 with ApaI restriction site Reverse primer for upstream region Δsaci0446 , overlapping region Forward primer for downstream region Δsaci0446 , overlapping region Reverse primer for downstream region Δsaci0446 with BamHI Forward sequencing primer Δsaci0446 Reverse sequencing primer Δsaci0446 Forward primer for upstream region Δsaci1242 with ApaI restriction site Reverse primer for upstream region Δsaci1242, overlapping region Forward primer for downstream region Δsaci1242, overlapping region Reverse primer for downstream region Δsaci1242 with BamHI Forward sequencing primer Δsaci1242 Reverse sequencing primer Δsaci1242 Δsaci1223 Forward for pyrEF exchange Δsaci1223 Reverse for pyrEF exchange Δsaci0133 Forward for pyrEF exchange Δsaci0133 Reverse for pyrEF exchange Δsaci1219 Forward for pyrEF exchange Δsaci1219 Reverse for pyrEF exchange saci0446 forward qPCR primer saci0446 reverse qPCR primer 15 2490 2491 2492 2493 1112 1113 1114 1115 1116 1117 1424 1425 1426 1427 696 697 3512 3513 2079 2080 2075 2075 1480 1481 4077 4078 4079 4080 4319 4320 4081 4082 4083 4084 4085 4086 4321 4322 4323 4324 4087 4088 5‘-AGCGGTGCTAAAGGCACAGAAG 5‘-GGTCTACCCGCCTTATTTACAG 5‘-GAGGCGTTGAAGTTCTGCTATGAC 5‘-CGCTCCTGTTTATGGAGGCTTTAG 5‘-GGGCCATGGTTCCGTCGGAAGTGTCAAC 5‘-GGAGACAGTACTTCAAATTCCATATC 5‘-GATTAAAATGAGTATAAACCAAG 5‘-GCCATATCCTCACTTATGACTTGG 5‘-CTGAGAGGCTAACGTCTCTAAATC 5‘-GAAGCAGGAGAAGAGAAGAAGAAG 5‘-ACTGCGTCTACTGCGTTATCTTTATC 5’-GGAGATAAGTCTACACTAGATACACCAGAA 5‘-GCAGTTGAAGAGTTAGCCTTATCTGTG 5‘-CCTACTAACTGACTTACGGTACTAATCT 5’-CTCTAATTTTAACGTCTCAGTAACTAGC 5’-CCTACTTGTTCCATAGGATTGTTAGG 5’-CTCCTGACTACCAACTGACTATTTATC 5’-GTTCACCAGTAGAATAGCTCTTTACAC 5’-TAGCCAGGGTATGTTCAGTAATC 5’-ACCTAAGTTCCCGTTATTGAC 5’-GCTAGTAAAGCCAACAAGAGTG 5’-ATATAGTCGCTGCTACCCTATG 5’-CCTGCAACATCTATCCATAACATACCGA 5’-CCTCATAGTGTATATGCTTTAGTAGTAG’ 5’-CGTCTATCGCTTTCGTGATCTG 5’-TCTTACCCTACGTACACGAGAG 5’-GCTCCCGAAGTCCATATAAGG 5’-GTTCTAGGTGGACTCGGTAAG 5’-AGTCGGACCATAGACACTAGAG 5’-GACACGCCAGGAGCTTTATATC 5’-ATCCTTATGCTGGTGGCTCTG 5’-TCTCGTTCCTCCCTTCCAATC 5’-CACCAGCCCTCTTCTCTAC 5’-GTCCTGCACTGACCAATACC 5’-GTGTTGTGATACCGGCATAC 5’-GGCGGAGTCGAACCATATAC 5’-TGCCTTCCCGTTATCATCAGTC 5’-TACAGTCGCTCTGAACGGATAC 5’-GGTCGATTGAGATCCCAGTTGTTC 5’-CTTTCTCCCTGACCTCCTTAAACC 5’-ATGTACCCGGACCTGGATATG 5’-TCGGATGCTGGCAAATCAC 2453 4067 5‘-CCCCCGAATTCGATGAGTATTGAAATTACTG 5‘CCCCGCGGCCGCTTAAATAAAAGACTTAATAAC 5‘GTACCATGGGTATTGAAATTACTGAAAAATATG 4068 5‘-GATGGATCCAATAAAAGACTTAATAACTTGG 4069 5‘-GATCCGCGGATACCCTGTCTGTTCTCTTC 5‘GTACGGCCGTTAAATAAAAGACTTAATAACTTG G 5’-ATACCCTGTCTGTTCTCTTC 5'-CAATACTCATTTTAATCTCGCC 5'-CAGTAGCCTATGGTCTTTCTGAATC 5’-CCTTCATGTTATCTCCTTTTTCCT 2454 4070 ep092 ep093 ep094 ep095 saci0102 forward qPCR primer saci0102 reverse qPCR primer saci0133 forward qPCR primer saci0133 reverse qPCR primer Saci1223 forward qPCR primer Saci1223 reverse qPCR primer Saci1242 forward qPCR primer Saci1242 reverse qPCR primer Saci1219 forward qPCR primer Saci1219 reverse qPCR primer flaB forward qPCR primer flaB reverse qPCR primer flaX forward qPCR primer flaX reverse qPCR primer aapA forward qPCR primer aapA reverse qPCR primer aapF forward qPCR primer aapF reverse qPCR primer upsA forward qPCR primer upsA reverse qPCR primer upsE forward qPCR primer upsE reverse qPCR primer secY forward qPCR primer secY reverse qPCR primer saci1904 forward qPCR primer saci1904 reverse qPCR primer saci1905 forward qPCR primer saci1905 reverse qPCR primer saci1906 forward qPCR primer saci1906 reverse qPCR primer saci1907 forward qPCR primer saci1907 reverse qPCR primer saci1908 forward qPCR primer saci1908 reverse qPCR primer saci1909 forward qPCR primer saci1909 reverse qPCR primer saci1910 forward qPCR primer saci1910 reverse qPCR primer saci1911 forward qPCR primer saci1911 reverse qPCR primer saci1912 forward qPCR primer saci1912 reverse qPCR primer Forward primer for cloning saci0446 into pETduET with EcoRI restriction site Reverse primer for cloning saci0446 into pETduET with NotI restriction site Forward primer for cloning saci0446 into pMZ1 with NcoI restriction site Reverse primer for cloning saci0446 into pMZ1 with BamHI restriction site Forward primer for cloning saci0446 into pSVA1450 with SacII restriction site Reverse primer for cloning saci0446 into pSVA1450 with EagI restriction site Forward EMSA probe (p/o) saci0446 Reverse EMSA probe (p/o) saci0446 Forward EMSA probe (ORF) saci0446 Reverse EMSA probe (ORF) saci0446 16 ep096 ep097 ep098 ep099 ep100 ep101 ep102 ep103 5’-ATTGCCTTCTCATCAGTATCATG 5’-CCTTCTTTTCATGTATATCATGTT 5’-CAGTATATCTATCAGCCTGATGG 5’-CTATAGGTATACCAACTCCTATC 5’-CTAATTACTTGTATACATTTGTAAG 5’-TAACGTGATATCATGGTAATCTTA 5’-CCGAAAACGATTAATGGTAAGGA 5’-GTGCACTCCTTAAAGAAAACACA Forward EMSA probe (p/o) saci1178 Reverse EMSA probe (p/o) saci1178 Forward EMSA probe (p/o) saci1177 Reverse EMSA probe (p/o) saci1177 Forward EMSA probe (p/o) saci2314 Reverse EMSA probe (p/o) saci2314 Forward EMSA probe (p/o) saci1908 Reverse EMSA probe (p/o) saci1908 17
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )