The mRNA Assay
Primers for HBA (hemoglobin alpha), G6PDH (glucose 6-phosphate dehydrogenase) and TEF
(transcription elongation factor 1a) were adopted from collaborative EDNAP exercises and forensic literature [19-21]. Forward primers were 5'-labeled with 6-FAM TM fluorescent phosphoramidite dye, and HPLC-purified primers were purchased from Sangon Biotech.
The primer sequences, expected amplicon lengths and concentrations are indicated in Supplementary Table 3 .
One nanogram of RNA was subjected to reverse transcription (RT) using the SuperScript III
First-Strand Synthesis System (Thermo Fisher) according to the random primer protocol. The resulting cDNA was used in the subsequent mRNA assay reaction. In brief, a RNA/primer mixture including 16
μl RNA, 2 μl random primers (50 ng/μl) and 2 μl 10 mM dNTPs was incubated for 5 min at 65°C, then placed on ice for 3 min. 18 μl cDNA Synthesis Mix (8 μl MgCl
2
, 4 μl 10× RT buffer, 4 μl 0.1M DTT,
2μl RNase Out TM ) was added to the RNA/primer mixture, mixed gently and briefly centrifuged. Half the volume (19 μl) were pipetted into a new tube and mixed with 1 μl H
2
O (RT- solution, without reverse transcriptase) to detect genomic DNA contamination. The other half (19 μl) were mixed with 1
μl Superscript III RT (200U/μl) to generate RT+ solution. The RT- solution and RT+ solution were incubated for 10 min at 25°C, then 50 min at 50°C, and 5 min at 85°C.
1 μl of each product was amplified by the mRNA assay using Qiagen multiplex PCR Kit in a mixture of 2 μl cDNA, 0.1–0.2 μM primers, 12.5 μl 2× QIAGEN Multiplex PCR Master Mix, 2.5 μl 5×
Q-Solution and RNase-free water to a total volume of 25 μl. Amplifications were performed on a
GeneAmp 9700 PCR System under the following conditions: 95°C for 15 min, 32 cycles of 94°C for
30 s, 58°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 10 min.
Amplified fragments were purified with the MinElute PCR purification kit (QIAGEN), and then separated and detected by capillary electrophoresis. One μl of PCR product was diluted in 12.5 μl

Hi-Di TM Formamide (Thermo Fisher) containing 0.5 μl of Orange 500 internal size standard
(PeopleSpot) and denatured for 3 min at 95°C followed by snap cooling on ice for 3 min. The following electrophoresis conditions were used for the 3130 Genetic Analyzers: 10 s injection time, 3 kV injection voltage, 15 kV run voltage, 60°C, 30 min run time. Profiles were analyzed using
GeneMapper ID 3.2.1 analysis software (Thermo Fisher). A peak detection threshold of 100 relative fluorescence units (RFUs) was used for positive marker identification calls

Supplementary Table 3 Three markers used for mRNA assay mRNA
HBA
Forward primer
ACGCTGGCGAGTATGGT
Reverse primer
CCCTTAACCTGGGCAGAG
Size (bp) Conc.
c
G6PDH ATCATCGTGGAGAAGCCCTTC GTTCCAGATGGGGCCGA
112
181
TGGGCCATCAACTGAGAAAGA TCTCCCTACACTTCAACTGCACA 206
0.1
0.2
0.1 TEF