SUPPLEMENTARY INFORMATION
Methods and Materials
Assays
To measure distribution of plasmid DNA, total DNA was prepared from 25 mg tissue
samples using a Qiagen DNeasy Kit and pDNA content was determined by TaqMan
quantitative PCR. The forward primer (5’-gcttctgacacaacagtctcgaa), reverse primer (5’aacctgtcttgtaaccttgatacttacct) and fluorogenic probe (5’-FAMttaagctgcagaagttggtcgtgaggc-TAMRA) hybridise to an 87 bp region common to all pCIderived plasmids used in this study. The results were normalized for genomic DNA input
relative to genomic ribosomal DNA using a TaqMan Ribosomal RNA Control Reagents
Kit (ABI). Each 25 µl reaction contained 5.0 µl template or standard, 12.5 µl TaqMan
Universal PCR Master Mix (ABI), 5 µM each primer and 100 µM probe. Reactions were
performed in 96-Well Optical Reaction Plates (ABI) as follows: (50°C for 2 min) x1,
(95°C for 10 min) x1, (95°C for 15 s; 60°C for 1 min) x40. The amount of DNA was
determined using ABI PRISM™ Sequence Detection Systems Version 1.6.3 software.
For mRNA analysis, samples were submerged in RNAlater buffer (Ambion Ltd.,
Huntingdon, Cambridgeshire, UK) and stored at <4oC until required. Samples were
homogenised in RLT (Qiagen) before extraction of total RNA with RNeasy reagents
(Qiagen). Plasmid-derived mRNA was quantified by real-time quantitative multiplex
TaqMan reverse transcriptase (RT) PCR using the pCI primers and probe described
previously [22]. Controls included no template control (NTC) and no RT control (-RT)
where total RNA or MultiScribe RT and RNase inhibitor were omitted from the RT
reaction respectively. The amount of plasmid-derived transgene mRNA was normalised to
1
rRNA content and expressed relative to a calibrator sample using the ∆∆CT method [26].
Two archive total RNA samples, BT1.1 and BT1.7, from a sheep lung segment treated
with pCIKCAT [4] were used as calibrators and included on each 96-well RT-PCR plate.
Preliminary study data were calibrated with BT1.7, but due to insufficient BT1.7, the main
study data were calibrated with BT1.1. As BT1.1 contains 500x more plasmid-derived
mRNA than BT1.7, relative expression values were adjusted by a factor of 500 where
appropriate to allow direct comparison.
Reference
26. Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402408.
2