Supplemental methods.
Biological samples
All samples were obtained at diagnosis for genetic evaluation after informed consent from
acute leukaemia patients treated at the Centre Henri Becquerel (adult cases) or the CHU
Charles Nicole (paediatric cases), Rouen. Bone marrow and blood samples that presented at
least 20% blast cells were obtained from consecutive patients between 2000 and 2014 for
childhood AML (n=30), ALL (n=180) and adult ALL cases (n=93) and between 2008 and
2014 for adult AML cases (n=237). This study was approved by the internal ethic review
board of our institution.
RNA extraction
RNA was isolated from bone marrow (n=388) or blood (n=152) samples using the RNA
NOW kit (Biogentex, Seabrook, TX, USA) following the manufacturer’s instructions and
stored at -80 °C.
RT-LDRTPCR procedure
All reactions were performed in a thermocycler with a heated lid (Mastercycler, Eppendorf,
Hambourg, Germany). Total RNA (500 ng) was diluted in 4 µl of water. After the addition of
7.5 µl of a reverse transcription mix (2.5 µl 5x RT-MMLV Buffer (Invitrogen, Carlsbad, CA),
1 µl DTT 100 mM, 2 µl dNTPs 10 mM and 2 µl random primers 100 µM), samples were
heated for 1 min at 80 °C, incubated for 5 min at 37 °C and cooled at 4 °C. MMLV-Reverse
transcriptase (1 µl) was added, and the samples were incubated for 15 min at 37 °C, heated for
2 min at 98 °C and cooled at 4 °C. cDNA (5 µl) was transferred to a new tube, and 3 µl of the
LD-RTPCR probe mix (1.5 µl SALSA-MLPA Buffer (MRC-Holland, Amsterdam, The
Netherlands) + 1.5 µl final dilution probe mix) were added. Samples were heated for 2 min at
95 °C and incubated for 1 h at 60 °C to allow the annealing of the LD-RTPCR probes. The
ligation step was performed by cooling all samples at 56 °C and adding 32 µl of a ligation
mix (3 µl SALSA-Ligase 65 Buffer A, 3 µl SALSA-Ligase Buffer B, 25 µl water, 1 µl
SALSA-Ligase 65 (MRC-Holland)). This mix was incubated for 15 min at 56 °C and heated
at 98 °C for 5 min to stop the ligation reaction.
For PCR amplification, 5 µl of the ligation products were transferred to new tubes containing
45 µl of a PCR mix (20 µl Red’y’Star Mix (Eurogentec, Liege, Belgium); 1 µl 10 µM 5’
1
biotinylated primer U1 (GGGTTCCCTAAGGGTTGGA), 1 µl 10 µM primer U2
(GTGCCAGCAAGATCCAATCTAGA) and 18 µl water). Alternatively, a biotinylated
primer U2 was used together with an unmodified primer U1 to allow the characterisation of
the junction from the other end. The amplification was performed as follow: 6 min at 94 °C;
35 cycles (30 sec at 94 °C, 30 sec at 58 °C, 30 sec at 72 °C); 4 min at 72 °C; and cooled at
16 °C. PCR products (10 µl) were analysed on 8% acrylamide / bis-acrylamide (40/1) gels,
and 20 µl were analysed using pyrosequencing to identify the two partner genes on a
PyroMark Q24 platform (Qiagen, Venlo, the Netherlands) with a 15(ACTG) dispensation
order following standard procedures.
LD-RTPCR probe design and preparation of the probe mix
The sequences of the LD-RTPCR probes are provided in Supplemental Table 1. All probes
were oligonucleotides (Eurofins MWG Operon, Ebersberg, Germany) composed of a genespecific region complementary to the fusion cDNA and fused to a 5’ or 3’ tail. All left probes
had the same GTGCCAGCAAGATCCAATCTAGA tail at their 5’ end. All right probes had
the same TCCAACCCTTAGGGAACCC tail at their 3’ end. All 3’ probes were
phosphorylated at their 5’ end to allow for the ligation reaction. All probes were pooled at a
final concentration of 1 fmol/µl each in Tris 10 mM/EDTA 1 mM to create the LD-RTPCR
mix.
Genetic analysis flowchart of our routine diagnosis platform
All acute leukaemia patients in our institution benefit from a cytogenetic analysis, preferably
from a bone marrow sample. FISH analysis is performed in some cases, depending on the
clinical context, on the availability of other materials (DNA and RNA extracted from blood or
bone marrow samples), and of the results of RT-PCR. The MLL gene rearrangements are for
example systematically addressed in young AML patients when no specific abnormality has
been detected by conventional cytogenetics or RT-PCR. When a rearrangement is identified
by this method, the result of the karyotype is modified accordingly. For B-ALL, four fusions
(BCR-ABL1, MLL-AFF1, RUNX1-RUNX1T1 and TCF3-PBX1) are systematically evaluated
using RT-PCR. Two fusions (STIL-TAL1 and BCR-ABL1) are evaluated for T-ALL. In AML,
RT-PCR assays are used to confirm all suspicions of RUNX1-RUNX1T1, PML-RARA or
CBFB-MYH11, based on previous cytological and/or cytogenetic observations. In rare cases,
specific RT-PCR assays are used to confirm rare abnormalities detected using conventional
cytogenetics (ZBTB16-RARA, KAT6A-CREBBP, DEK-NUP214).
2