supplemental Figure legends
supplemental Figure 1
A representative of Southern-blot image.
Southern-blot image of nine
mito-mice (the first litter of mouse-3) is shown. The upper 16.3 kbp and the
lower 11.6 kbp signals indicate wild-type mtDNA and mtDNA, respectively.
Lanes 1-5 are female and lanes 6-9 are male mito-mice.
supplemental Figure 2
Relationship between age and total mtDNA content in tissues.
samples for each mito-mouse are represented.
and the other is obtained at euthanasia.
In graph (A), two
One is obtained at 30 days old
supplemental Figure 3
Relationship between proportion of mtDNA and total mtDNA content in tissues.
In graph (A), two samples for each mito-mouse are represented. One is
obtained at 30 days old and the other is obtained at euthanasia.
supplemental Figure 4
Changes in proportions of mtDNA in tissues with age (without mice possessing
more than 80% mtDNA). (A)-(K) Relationship between proportion of mtDNA
in tissue and age at euthanasia. Proportions of mtDNA in tissues shows ratios
relative to those in tail at age a month. Pearson’s product-moment correlation
coefficient and its probability are indicated in the graphs as R and P, respectively.
(L) Rates of accumulation of mtDNA in tissues.
(ratio/month) in graphs (A)-(K) are indicated as bars.
The slopes of best fit
supplemental Figure 5
Relationship between proportion of mtDNA in offspring and maternal age.
Proportion of mtDNA in the tails of offspring at 30 days old are indicated by blue
diamonds. Proportion of mtDNA in the tails of maternal mito-mice at 30 days
old are indicated by red crosses. Horizontal axes indicate the age of the
maternal mito-mice at each delivery. In some offspring, mtDNA was not
detected (mouse-S1: one of 11 in the third litter and three of five in the fourth
litter).
supplemental Method
Estimation of total mtDNA content by real-time monitoring PCR: In order to
compare the total mtDNA content in tissues, nuclear gene GAPDH was
measured as a internal control and Ct method was used. For this real-time
monitoring PCR, Quantitect Cyber Green Kit (Qiagen, Hilden, Germany) was
used. Each measurement was repeated three times and mtDNA contents per
GAPDH genome were calculated. The primer set specific for GAPDH was
AACGACCCCTTCATTGAC and TCCACGACATACTCAGCAC. The primer set
specific for both wild-type and mtDNA was CCCACGATCAACTGAAGCAGCAA
and ACCGTTTGTTTGTTGTTGAAATATT.