Name:_____________________________________________ Date:_____________________ Block:_______
Background
In the early 1900s, the Russian Revolution ousted the Romanov family
from its rule. The Romanovs were on the run. Long story short, they
were found in Siberia and brutally murdered, then buried in a mass
grave along with some of their servants.
Fast forward to the year 1998, and as is the case with these kinds of
stories, someone has claimed to be a long lost relative to the Romanov
family. Her name is Ana, and she’s 28 years old. She claims that her
great grandmother is the Princess Anastasia. “But there is no record of
Anastasia having any children!,” the chief investigator told her. Below
is her response.
“She kept her pregnancy a secret with the help of her favorite servant.
Together they devised a brilliant plan to wear baggy sweaters for 5
months. And when it came time to give birth, she went on a two-week
‘backpacking trip’ through Europe. The servant took the baby girl, my
grandmother, and gave her to a Russian peasant family. She had a
child, my mother, who moved to the U.S. when she was very young.”
The police chief knows this story sounds bogus, but he decides to test her
knowledge of genetics and offer to have a mtDNA sample run to prove or disprove her claim.
Part 1:
Answer the questions below. These are the same questions that Ana had to answer.
1. Where did you get your mitochondrial DNA from?
2. And where did that person get their mtDNA from?
3. So explain how mtDNA is inherited!
4. Using what you know of mtDNA inheritance. Shade in all the individuals below that have identical
mtDNA to the shaded female.
Part 2:
Because Ana seems to know a lot about genetics, the police chief continues the
investigation and sends a cheek swab sample to Ladders-R-Us Labs for
mtDNA sequencing.
Lucky for us, the remains of Queen Victoria of England, the Princess
Anastasia’s grandmother, have been sequenced thanks to an initiative called
the I’ll-Be-Back Coalition, whose mission it is to store DNA samples of famous
historical persons so they can be cloned in the future and made to fight one
another in a martial arts tournament!
Go to the website: blast.ncbi.nlm.nih.gov and click on Human.
Now you are going to compare Ana’s mtDNA to that of Queen Victoria. Victoria’s sequence is already on the
database. Below is Ana’s sequence that was sent back from the lab. Don’t be silly and try to type all 397 bases
in yourself. Go to www.edensbio.wiki.k12.pa.us and copy it from the file in the Classroom Resources section.
Paste the sequence into the BLAST website where it says “Enter Query Sequence.”
Scroll to the bottom of the page and click “BLAST”. What the website will do now is compare the sequence you
input into the computer to that of Queen Victoria.
TATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATG
TATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACATAAA
AACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATC
AACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACTCACCCTTAACAGTACATAGTACA
TGAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGG
GGTCCCTTGACCACCATCATCCTC
Scan carefully through the sequence. The query sequence is what you entered into the system. The Subject
sequence (bottom) is Queen Victoria’s.
Questions:
1. Is the sequence a match?
2. Does it have any differences? If so, how many?
3. Does it matter if there are any differences in the sequence?
4. Knowing that mtDNA is highly conserved through generations, with a partner, come up with several
questions you could ask that mtDNA could help you to answer.