EFFECTS OF LIPOPOLYSACCHARIDE TIME EXPOSURE ON CELL VIABILITY
AND PRO-INFLAMMATORY CYTOKINE EXPRESSIONS OF PALMITIC ACID
TREATED THP-1
Annette d’Arqom1a,*,2, Voravich Luangwedchakarn1,#, Pinklow Umrod1
1
Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University,
Thailand
a
Graduate programe in Immunology
2
Department of Pharmacology, Faculty of Medicine, Airlangga University, Indonesia
*e-mail: annette.dar@student.mahidol.ac.th #e-mail: voravich.lua@mahidol.ac.th
Abstract
Metabolic endotoxemia is an emerging hypothesis in immunology, refers to
increasing of endotoxin plasma in the level that cannot induce sepsis. It has been connected to
pathogenesis of chronic inflammation condition in obesity, insulin resistance, and
malignancies. In obesity, high level of saturated fatty acids (SFAs), such as palmitic acid
(PA) was observed. Moreover, PA can activates pathogen recognition patterns (PRRs) and
leads to pro-inflammatory cytokines production. This is also a result from cross-talk of
macrophages and adipocytes in adipose tissue. Increasing lipopolysaccharide (LPS) level in
the blood also monitored after high fat diet and correlated with low grade chronic
inflammation. Aim of this study is to observed effect of LPS time incubation on cells
viability and pro-inflammatory cytokine mRNA expression of palmitic acid treated THP-1
cells. Combination of PA and low dose LPS reduce cell viability after 8 hours incubation
with LPS 1 ng/ml (82.5 + 2.5%, p < 0.0001). This combination also increases cytokine
mRNA expressions with different dynamic for each cytokine. TNF-α (44.045 + 12.851), IL-6
(45.413 + 11.759), and IL-8 (146.836 + 23.385) reach the highest expression at 4 hours (p >
0.05, p < 0.05, p < 0.0001, respectively). While IL-1β mRNA expression increase maximally
after 2 hours exposure time of LPS (285.841 + 44.815, p > 0.05). This finding shows
exposure to LPS low dose can enhance inflammatory response to PA. Longer exposure time
might bring detrimental effect to the cells.
Keywords: palmitic acid, lipopolysaccharide, metabolic endotoxemia
Introduction
Metabolic endotoxemia is a new hypothesis in immunology. It refers to increasing of
blood endotoxin (lipopolysaccharide) in subclinical level which lowers than sepsis (2). It has
been linked to low chronic inflammatory condition that usually occurs in obesity, insulin
resistance, malignancies, etc. Mechanisms on how LPS activate immune system in sepsis or
cytokine storms are clearly established. In the other hand, how low dose of LPS induced
secretion of cytokines, adipokines, and other mediators is unclear. Furthermore, the causes,
effects, and molecular mechanisms still need further investigation. Many studies try to reveal
the causes of metabolic endotoxemia, such as smoking, alcohol intake, and high fat diet (3-5).
Increasing saturated fatty acids (SFAs), such as palmitic acid (PA) is correlated with
obesity marker (6). Several studies discover that SFAs can activate TLRs and further activate
NF-κB pathway (7-10). Increasing on pro-inflammatory cytokines, both in mRNA and
protein level, are results of this process (9, 11-13).
Murine study by Cani, et al shows correlation between fat intake and increase of
endotoxin level in the blood and further induces insulin resistance (14). Changes in gut
bacteria probably an answer why the LPS can escape to the blood circulation (15). How long
this LPS has an effect on the body after fat diet is also still unclear. Thus, this study try to
reveal the effect of low dose LPS time exposure on PA treated human monocytic cell line in
term of cell viability and pro-inflammatory cytokine mRNA expressions.
Methodology
Cell culture
THP-1 cells (American Type Culture Collection, Virginia, USA) were cultured in
ATCC modified RPMI-1640 that contained 4.5 g/L of D-Glucose, 2.383 g/L of HEPES
buffer, L-Glutamine, 1.5 g/L of Sodium Bicarbonate, 110 mg/L of Sodium Pyruvate, 0.05
mM of 2-mercaptoethanol (2-ME), 10% heat inactivated Fetal Bovine Serum, with 100 U/ml
of Penicillin and 100 µg/ml of Streptomycin (pH 7.2-7.4) and incubated at 5% CO2, 37°C.
Cells were maintained at a density not more than 1x106 cells/ml. Trypan blue staining was
used to determine cell viability.
Palmitic acid preparation
NaOH 1 N was diluted to final concentration 0.3 N with endotoxin free water and
mixed with absolute ethanol (3:7). This solution was used to dissolve 0.01 gram of palmitic
acid (Sigma-Aldrich, Saint Louis, USA) until final concentration 0.039 M and heated to
70ºC. Furthermore, 0.039 M palmitic acid were diluted to 50 – 200 µM using complete RPMI
containing 10% FBS, and incubated in 37°C for 30 minutes to let palmitic acid bound to
albumin in FBS. This solution was prepared freshly prior to experiment. Palmitic acid
solution was added to cell suspension at 1:1 ratio.
Lipopolysaccharide preparation
One mg/ml stock of lipopolysaccharide (LPS) was made by dissolving 1 mg LPS in 1
ml endotoxin free water and stored in -20ºC until used. Further dilutions were performed to
reach final concentration 1 µg/ml. For cell stimulation, LPS were added to complete RPMI
with 10% FBS to final concentration of 2 ng/ml, and added to cell suspension at 1:1 ratio.
PA and LPS stimulation
Methods from Schwartz, et al. were adapted . Briefly, cells (5x105 cells/ml) were resuspended in complete media with palmitic acid 100 µM and seeded in 6-well plates (2 ml).
After incubated for 4 hours, they were washed with DPBS before LPS stimulation (1 ng/ml)
or adding media for 4 hours (13). Furthermore, cells were collected and resuspended with 50
µl DPBS and 350 µl RNAlater™ to preserved RNA.
RNA extraction, cDNA synthesize, and qRT-PCR
Total RNA of stimulated cells was extracted using Invitrap® Spin Universal RNA Mini
Kit (Invitek GmbH, Berlin, Germany) following the manufactured instruction. Briefly, cells
were lysed and homogenized before applied in the column. After washing, total RNA was
eluted and continuously converted to cDNA by M-MLV reverse transcriptase using the
Superscript™ III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA). Up to 5 μg
of total RNA were converted to cDNA following the manufactured instruction. Reverse
transcription reaction was performed in an PCR machine GeneAmp® PCR System 9700. The
cDNA were directly used either for conventional and real time PCR or stored in -20ºC. The
expressions of gene of interest were determined by semi-quantitative real-time PCR on the
CFX96™ Real-Time PCR Detection System. The reactions were performed using 1X
Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix containing 2.5 mM MgCl2 and 0.4
μM of each forward and reverse primer, under the following condition: heat-denaturation at
95°C for 3 minutes followed by cycled amplification at 95°C for 5 seconds, 59°C for 10
seconds and 72° for 5 seconds for 40 cycles. Changes on gene expression were measured
with ddCt calculation. The individual primer pairs and the expected PCR products were
shown below.
Table 1. Primer sequences
Gene
Accession no.
GAPDH
NM_002046.4
TNF-α
NM_00059.2
IL-1β
NM_000576.2
IL-6*
NM_000600.3
IL-8
NM_000584
Primer (5'-->3')
F
ACAGCCTCAAGATCATCAGCA
R
GATGGCATGGACTGTGGTCA
F
CAGGCAGTCAGATCATCTTC
R
CTGGTTATCTCTCAGCTCCA
F
TGGAGCAACAAGTGGTGT
R
TTGGGATCTACACTCTCCAGC
F
CGGGAACGAAAGAGAAGCTCTA
R
GGCGCTTGTGGAGAAGGAG
F
GCCAACACAGAAATTATTGTAAAGCTT
R
AATTCTCAGCCCTCTTCAAAAACTT
Size (bp)
119
147
157
68
112
* Primers of IL-6 were quoted from previous study (1)
Statistical analysis
One way ANOVA was used to analyze whether there is a different between each
condition and post hoc test (Tukey) was performed. All data were analyzed by GraphPad
Prism 3.00.
Results
Cell viability under PA and LPS low dose influence
The results showed cell viability after treated with PA alone in all incubation time
were more than 90%. But in the cell that treated with low dose LPS for 8 hour, cell viability
(82.5 + 2.5%) was reduced compared to media (p < 0.0001) (Figure 1).
Figure 1. Effect of LPS time exposure on PA treated THP-1 cell viability. Cells were treated with PA 100 µM
for 4 hours, followed with (white bar) or without (gray bar) LPS 1 ng/ml for several incubation time (0, 2, 4, 8
hours). Cells viability was measured by trypan blue exclusion. Results are presented as mean ± SEM of three
independent experiments. * compared to untreated, # compared to before LPS stimulation. *,# P < 0.05, **,## P <
0.01, ***,### P < 0.001.
Pro-inflammatory cytokine mRNA expressions
qRT-PCR results show PA or LPS low dose itself can induce all pro-inflammatory
cytokine mRNA expressions. Moreover, combination of PA and LPS exaggerate their
expressions in all incubation time. Each cytokine expressions has different dynamic, but in
average, LPS low dose exposure for 4 and 8 hours give the highest different between LPS
and PA + LPS (Figure 2).
Figure 2. Effect of LPS on PA treated THP-1 cells on pro-inflammatory cytokine expressions. Real-time PCR
analyses of pro-inflammatory cytokine expressions: TNF-α, IL-1β, IL-6, and IL-8, after treated with 100 µM of
PA for 4 hours, followed with or without LPS 1 ng/ml. Results are presented as mean ± SEM of three
independent experiments. * compared to LPS. * P < 0.05, ** P < 0.01, *** P < 0.001.
For TNF-α, LPS low dose alone induce cytokine mRNA expression with the peak at 2
hours, reduce at 4 hours, and diminish at 8 hours. Combination of PA and low dose LPS give
a different pattern but not significantly different. Its expression starts to increase since the
beginning and reach the peak at 4 hours and decline at 8 hours.
For IL-1β, both LPS and PA + LPS reach the peak at 2 hours and decrease at 4 and 8
hours, but not significantly different. Interestingly, combination of PA and LPS induce higher
mRNA expression than LPS alone.
Interleukin 6 and IL-8 have similar pattern in their cytokine gene expressions. LPS
low dose alone induce cytokine mRNA expression with the peak at 2 hours and start to
reduce. Moreover, LPS stimulation on PA treated THP-1 cells increase the expression on 2
hours, reach peak at 4 hours, and decline at 8 hours (IL-6 p < 0.05, IL-8 p < 0.001).
Therefore, the longest LPS exposure time for TNF-α, IL-6, and IL-8 gene expression
is 4 hours. This exposure time changes the mRNA expressions (fold change) of TNF-α
(44.045 + 12.851), IL-6 (45.431 + 11.759), and IL-8 (146.836 + 23.385). While IL-1β reach
the highest expression at 2 hours (285.841 + 44.815)
Discussion and Conclusion
The source and the cause of metabolic endotoxemia or metaflammation is complex
and poorly understood (16). High level of free fatty acid that found in obesity, can promotes
cross-talk between macrophages and adipocytes, leads to low grade inflammation.
Furthermore, increasing of LPS level post-free fatty acid consumption induces more
inflammation (14). In this present study, combination of PA and low dose LPS exaggerate
inflammation of THP-1 cells. Longer time exposure of low dose LPS on PA treated THP-1
cells can reduce cell viability, and enhance cytokine mRNA expression. These effects vary
between each cytokines, but in a same trend. Two until 4 hours LPS treatment after PA
stimulation induce the highest cytokines expression. In line with reduction of cell viability,
cytokine mRNA expressions diminish after 8 hours.
The mechanisms of how this phenomenon occurs are still under investigation.
Enhancement in inflammation induces by PA with LPS, probably caused by TLR-2 and TLR4 activation at lipid raft (7-10, 17-19). This process activate MyD88 dependent and
independent pathway, further activate NFB translocation (7). Moreover, PA also induces
phosphorylation of kinase family such as MAPK, JNK, ERK1/2, and p38. Their
phosphorylations activate inflammation-related transcription factors, such as NF-B, C/EBP,
and AP-1 (13, 20). Interestingly, inflammasome might have contribution in inflammation
caused by PA, as PA can acts as the second signal for inflammasome activation (21). This
activation not only lead to IL-1β and IL-18 processing, but promote activation of NF-B and
AP-1, resulted in enhancing transcription of others pro-inflammatory cytokines (22).
References
1.
Tchernof A, Després J-P. Pathophysiology of Human Visceral Obesity: An Update. Physiol Rev. 2013
January 1, 2013;93(1):359-404.
2.
Chang S, Li L. Metabolic Endotoxemia: A Novel Concept in Chronic Disease Pathology. J Med Sci.
2011;31(5):191-209.
3.
Hasday JD, Bascom R, Costa JJ, Fitzgerald T, Dubin W. BActerial endotoxin is an active component
of cigarette smoke*. CHEST Journal. 1999;115(3):829-35.
4.
Parlesak A, Schäfer C, Schütz T, Bode JC, Bode C. Increased intestinal permeability to
macromolecules and endotoxemia in patients with chronic alcohol abuse in different stages of alcohol-induced
liver disease. J Hepatol. 2000 5//;32(5):742-7.
5.
Laugerette F, Vors C, Peretti N, Michalski M-C. Complex links between dietary lipids, endogenous
endotoxins and metabolic inflammation. Biochimie. 2011 1//;93(1):39-45.
6.
Warensjo E, Margareta O, Bengt V. Fatty acid composition and estimated desaturase activities are
associated with obesity and lifestyle variables in men and women. Nutrition, Metabolism & Cardiovascular
Diseases. 2006;16:128-36.
7.
Huang S, M. RJ, G. SR, Ono-Moore K, Schneider DA, Newman JW, et al. Saturated fatty acids
activate TLR-mediated pro-inflammatory signalling pathways. J Lipid Res. 2012;53:2002-13.
8.
Lee JY, Plakidas A, Lee WH, Heikkinen A, Chanmugam P, Bray G, et al. Differential modulation of
Toll-like receptors by fatty acids: preferential inhibition by n-3 polyunsaturated fatty acids. J Lipid Res.
2003;44:479-86.
9.
Weatherill AR, Lee JY, Zhao L, Lemay DG, Youn HS, Hwang D. Saturated and Polyunsaturated Fatty
Acids Reciprocally Modulate Dendritic Cell Functions Mediated through TLR4. J Immunol. 2005;174:5390-7.
10.
Shi H, Kokoeva MV, Inouye K, Tazameli I, Yin H, Flier JS. TLR 4 links innate immunity and fatty
acid-induced insulin resistance. J Clin Invest. 2006;116(11):3015-25.
11.
Erridge C, Samani NJ. Saturated Fatty Acids Do Not Directly StimulateToll-Like Receptor Signaling.
Arterioscler Thromb Vasc Biol. 2009;29:1944-9.
12.
Laine PS, Schwartz EA, Wang Y, Zhang W-Y, Karnik SK, Musi N, et al. Palmitic acid induces IP-10
expression in human macrophages via NF-kB activation. Biochem Biophys Res Commun. 2007;358(1):150-5.
13.
Schwartz EA, Zhang W-Y, Karnik SK, Borwege S, Anand VR, Laine PS, et al. Nutrient Modification
of the Innate Immune Response: A Novel Mechanism by Which Saturated Fatty Acids Greatly Amplify
Monocyte Inflammation. Arterioscler Thromb Vasc Biol. 2010 April 1, 2010;30(4):802-8.
14.
Cani PD, Amar J, Iglesias MA, Poggi M, Knauf C, Bestelica D, et al. Metabolic Endotoxemia Initiates
Obesity and Insulin Resistance. Diabetes. 2007;56:1761-72.
15.
Manco M, Putignani L, Bottazzo GF. Gut Microbiota, Lipopolysaccharides, and Innate Immunity in
the Pathogenesis of Obesity and Cardiovascular Risk. Endocr Rev. 2010;31(6):817-44. PubMed PMID:
20592272.
16.
Gregor MF, Hotamisligil GS. Inflammatory Mechanisms in Obesity. Annu Rev Immunol.
2011;29(1):415-45. PubMed PMID: 21219177.
17.
Dasu MR, Jialal I. Free Fatty Acids in the presence of High Glucose Amplify Monocyte Inflammation
via Toll-like Receptors. Am J Physiol Endocrinol Metabol. 2010 October 19, 2010.
18.
Samuvel DJ, Jin J, Sundararaj KP, Li Y, Zhang X, Lopes-Virella MF, et al. TLR4 Activation and IL-6Mediated Cross Talk between Adipocytes and Mononuclear Cells Synergistically Stimulate MMP-1 Expression.
Endocrinology. 2011 December 1, 2011;152(12):4662-71.
19.
Wong SW, Kwon M-J, Choi A, M.K, Kim H-P, Nakahira K, Hwang D. Fatty Acids Modulate Toll-like
Receptor 4 Activation through Regulation of Receptor Dimerization and Recruitment into Lipid Rafts in a
Reactive Oxygen Species-dependent Manner. J Biol Chem. 2009;284(40):27384-92.
20.
Hotamisligil GS, Erbay E. Nutrient sensing and inflammation in metabolic diseases. Nat Rev Immunol.
2008;8:923-34.
21.
Wen H, Gris D, Lei Y, Jha S, Zhang L, Huang MT-H, et al. Fatty acid-induced NLRP3-ASC
inflammasome activation interferes with insulin signaling. Nat Immunol. 2011 05//print;12(5):408-15.
22.
Barker BR, Taxman DJ, Ting JPY. Cross-regulation between the IL-1β/IL-18 processing
inflammasome and other inflammatory cytokines. Curr Opin Immunol. 2011 10//;23(5):591-7.