Original scenerio by Barry Sharpio
This is a complete laboratory unit utilizing the following critical thinking skills and
abilities:
• Following explicit directions
• Problem solving
• Model building
• Story telling
• Essay writing
Project Chimera will require between 20 and 30 hours to solve and complete with a
combination of class time and homework.
OBJECTIVES:
After completing this assignment, students should be able to:
• understand the importance of DNA in the manufacturing of cellular proteins (protein
synthesis).
• demonstrate knowledge in understanding the concepts of protein synthesis.
• explain and show how DNA is used to manufacture proteins.
• acquire a working vocabulary of terms related to molecular genetics and protein
synthesis.
• write two scientific essays relating the theories and applications of molecular genetics.
• decode strands of DNA to determine possible characteristics based on protein analysis.
• create a three dimensional model to represent the decoding of DNA sequences.
• create a representative diorama showing the biome that your model animal will inhabit.
• relate the importance of the gene pool to the survival factor within a prescribed habitat.
• demostrate how DNA and molecular genetics relate to evolution
DIRECTIONS:
(NEATNESS IS CRITICAL TO THE SUCCESS OF YOUR PROJECT)
SCENARIO:
You are a research scientist in charge of a top secret molecular genetics project, code
named "THE CHIMERA PROJECT ". The primary goal of this project is to create a
DNA database that encodes for proteins that govern the general characteristics of animals
to ensure that they are best adapted for their environment which will allow them the best
chances for survival.
However, you believe that someone else knows about your research and is trying to
sabotage your results and terminate the project. There is good evidence that someone has
broken into the genetics laboratory and has altered or even stolen your secrets. You order
an investigation and determine that, indeed, there has been a break-in. Someone has
broken the genetic code and has removed Strand B from your experimental model. You
realize that with Strand A you should be able to successfully recode Strand B.
Hopefully, the saboteurs have not made any further attempts to alter the strand. Your job,
as head genetics researcher, is to recode Strand B from Strand A and then determine all
of the characteristics of your model animal. Only then, will you be able to determine if
the saboteurs were successful. You should be able to complete this project by following
explicitly the following directions below:
[ 1. ] At the end of this lesson you will find the complete DNA sequencing of Strand A
including all of the exons and introns. Your first task is to remove all of the introns so the
remaining exon nucleotides will be functional in manufacturing the correct proteins. To
simplify matters for this laboratory investigation there are only three different introns.
The nucleotide sequences for each of these introns are as follows:
• INTRON 1: TACAAATACAGAAATACAGAA
• INTRON 2: TACCCACTCGCC
• INTRON 3: TACCGCCTCTACAAAACT
Remove all of the introns from the original DNA sequence. Make a list of all of the
introns that were stripped out of the original sequence and title it: "INTRON'S
REMOVED". This list should show the INTRON NUMBER (i.e. Intron 1, Intron 2, or
Intron 3) and the correct sequence that the introns were removed (i.e. Intron 2 - Intron 3 Intron 2 - Intron 1 - etc.) Construct your list so each Intron is listed on a separate line.
Your completed list should be submitted with your final project.
[ 2. ] Once the introns have been removed, use the exons to write the exact nucleotide
sequence on Strand A of your double helix molecule. Make sure that you copy the order
exactly and that all introns have been stripped out. Make sure that the nucleotides follow
the double helix and coil from side to side down the DNA double helix. Each nucleotide
should be written so it is centered on each chemical bond. Do not write them in between
the lines on the spaces. For example, they should look like: -G or -T.
[ 3. ] Now that you have completed Strand A, recode Strand B according to the concepts
of DNA replication. Write the complementary base pair on Strand B. For example, AGC
on Strand A becomes TCG on Strand B. Write one nucleotide letter per chemical bond
line. The nucleotide letter should be at the center of each chemical bond line. Make sure
that you connect the nucleotides on Strand A to the nucleotides on Strand B with the
correct amount of hydrogen bonds. Draw in the hydrogen bonds between the
complimentary base pairs using dotted lines.
[ 4. ] Once the DNA double helix is complete you will transfer this information to the
"PROTEIN SYNTHESIS WORKSHEET". Copy Strand A onto the worksheet one
nucleotide at a time centered on the chemical bond line. For example write AGC one
letter per chemical bond on the DNA column. Make sure that each nucleotide is centered
on the chemical bond line. When you have completed Strand A, do the same for Strand
B. Make sure that you fully label all of your work with Strand identification and page
number so that you will not get the work for Strand A and Strand B mixed up at any
point. That would be disastrous to your results.
[ 5. ] After you have completed copying the DNA nucleotide order, check it one more
time to make sure that it is correct. If there is a single error in your DNA chain all of your
hard work and results will probably be incorrect. It is best to recheck your work at this
time.
[ 6. ] Your DNA message is now ready for decoding into mRNA, a process called
transcription. Using the "PROTEIN SYNTHESIS WORKSHEET" decode each DNA
nucleotide into its mRNA complement. For example, C in DNA language becomes G in
mRNA language and vise-versa while T becomes A and A becomes U since there is no T
in mRNA language. To go back to the original example, AGC in DNA will become UCG
in mRNA. As each group of three nucleotides in DNA is called a triplet, each group of 3
nucleotides in mRNA is referred to as a codon. Work through all of the triplets in both
strands and translate them into the correct codons.
[ 7. ] The mRNA message can now leave the nucleus and travel through the endoplasmic
reticulum to the ribosomes which are the actual sites of protein synthesis. Here the
mRNA codon will be translated into atRNA anticodon. The tRNA anticodon is able to
attach to a specific amino acid. To show this on your model write the tRNA anticodon
next to the mRNA codon and place a small bracket around the three anticodon
nucleotides. At the point of the bracket write the correct amino acid. The correct amino
acid can be interpreted by using the "mRNA Codon Translation Sheet". Locate the
first letter in the first base column, the second letter in the second base column and lastly
the third letter in the third base column. You should now be looking at a single amino
acid. Write the amino acid code next to the bracket. For example the UCG mRNA codon
will be translated to an AGC anticodon attached to the amino acid Serine. Remember,
you use the mRNA codon when you look up the amino acid, not the tRNA anticodon.
Most amino acids are written using the first three letters of their name. For example:
Phenylalanine= Phe, Leucine= Leu, Tyrosine= Tyr, etc. However, there are a few
exceptions as follows: Tryptophan= Tryp, Isoleucine= Ileu, Asparagine= AspN, and
Glutamine= GluN. Use these Amino Acid codes on your worksheet.
[ 8. ] When you have completed all of the Amino Acids, search both strands to locate the
correct amino acid sequences that will code for the proteins that will represent the
characteristics of your animal. The sequences must be absolutely identical.
[ 9. ] When you locate a protein, draw a box around the entire amino acid chain using a
colored pencil or pen and then label which protein you have located such as PROTEIN
7A or PROTEIN 11B, ETC. and its characteristic.
[ 10. ] Sometimes proteins can be suppressed, masked, or inhibited by the presence of
certain sequences of nucleotides. To show how this works in this project there is one
inhibitor sequence. When this sequence precedes a sequence that codes for a protein that
protein is inhibited and is not expressed. It is as if the protein didn't exist at all and the
animal will not possess the inhibited characteristic. Make sure that you check each
protein for the presence of an inhibitor sequence. If you find an inhibitor sequence make
sure that you highlight or box in that sequence with a different color on your worksheet.
The inhibitor sequence is as follows: GGGAGTTGCCCA
[ 11. ] Make a separate list of all of the proteins that you have found along with their
characteristics. Write the amino acid sequence, the protein number and its characteristic.
This list should be titled "LIST OF CHARACTERISTICS" and submitted with your
final project. Take your "AMINO ACID CODES FOR PROTEINS" form and
highlight each of the characteristics that were expressed for your animal. If the protein
expression is inhibited, make sure that you state that fact in your list and on your sheet.
Make sure that this sheet is also submitted with your final project.
[ 12. ] Once you have located all of the proteins and have complete the protein
characteristic list you are ready to construct a model of your animal. The model should be
three dimensional and not just a drawing or painting. It can be any size but remember that
you have to get it to school. Your model should clearly show all of the characteristics that
are coded. The model can be done in clay, plaster of Paris, paper mache, or any other
medium that you select to create your model. You cannot take a toy, stuffed animal, or a
doll and use it as your model. You must construct an original model. The type of animal
that you create is totally up to you. If a real animal exists with all of these characteristics
then you certainly may use that animal for your model. However, if there is no real
animal that exhibits all of the protein characteristics then you will have to create one. You
really can create your own animal in either circumstance. The key idea is to show all of
the DNA coded characteristics. You may be creative with your animal but don't get
carried away. The characteristics are real so the animal should be realistic. You may take
parts from different animals and fuse them together to make your animal. Hence the
name "The Chimera Project". Each characteristic has a specific adaptation to a particular
habitat, biome, or mode of life. Animal adaptations enable an organism to be better fit in
its environment and allow the species a better chance of mating and survival. Remember
these concepts in the creation of your animal.
[ 13. ] A "Biome Spinner" spinner will be available in the class. When you are ready for
this part of the project ask to use the Biome Spinner. Give it a good spin. The biome that
your spinner land on determines the biome that your animal inhabits. You will get only
one good spin. When your biome is determined, enter your name and the biome on the
Biome List in the classroom. The importance of this lab is to show that certain
characteristics are better adapted to certain habitats and biomes. Now you need to create a
diorama for your animal so you will be able to see the animal in its natural surroundings.
Constuct a diorama using a shoe box or other type of box and try to make it look like the
natural surroundings of that habitat.
[ 14. ] Write an essay explaining whether or not each of the characteristics that your
animal possess is adapted to that biome that was selected by the Biome Spinner. The
more characteristics that are adapted to that biome the more successful that animal will be
in surviving and reproducing. Based on your proteins and their characteristics, you should
be able to comment on whether the saboteurs were successful in destroying your project.
Write a statement in your conclusion expressing whether or not you think the saboteurs
were successful. This essay should be titled and submitted with your final project.
[ 15. ] Your second essay is an essay explaining the complete process of protein
synthesis. Use this project as a reference guide for citing examples in writing your essay.
Your essay should will probably be 4 - 8 pages (that's single sided) in length as it should
discuss all aspects of protein synthesis and gene expression. Your essay should be written
so that you understand the concepts in your own words and that they are not just copied
out of a textbook. Make sure that your essay is organized and that it flows and makes
sense. You can use illustrations were necessary to help explain certain processes.
[ 16. ] Make sure everything is neat, fully labeled, and stapled together in order of the
grading sheet. Your name should be on all of your written papers as well as on your
model. Your grading sheet should be the first page of your project!
[ 17. ] Take your original DNA helix sheet and cut out the double helix. Attach the
bottom of the first section to the top of the second section, the bottom of the second
section to the top of the third and so on until you have completed one long strand. Use
glue or scotch tape to secure the sections together. When you cut out each section, make
sure that you leave a small tab above and below each row so you can connect them
together securely and still see all of the individual nucleotides. This long DNA double
helix should be folded (accordion style) and put into an envelope. Close the envelope
with a paper clip and attach it to your final project. Make sure that your name is on the
envelope and helix.