Biology 30
Unit C – Molecular Genetics: DNA
General Outcome C3: Students will explain classical genetics at the
molecular level.
A.
DNA
Until now, we have looked at genes as abstract entities that somehow control
hereditary traits. Through purely genetic analysis, we have studied the inheritance of
different genes.
But what about the physical nature of the gene? This question puzzled scienteists for
many years until it was realized that genes are composed of deoxyribonucleic acid
(DNA) and that DNA has a fascinating structure.
1. Genes – the hereditary “factors” described by Mendel – were known to be
associated with specific character traits, but their physical nature was not understood.
2. Genes were known to be carried on chromosomes.
3. The chromosomes were found to consist of DNA and protein.
FYI
Deoxyribonucleic acid.
The simplest forms of life all contain DNA.
It is the only molecule that we know can replicate itself.
DNA makes up the genes (30,000 – 35,000) found on the chromosomes.
It provides continuity of life from generation to generation.
It is responsible for cells ability to repair itself and reproduce.
It may be changed by a mutation but will still function.
Discovered in 1953 by James Watson and Francis Crick (nobel prize in 1962)
B. Structure of DNA
Although the DNA structure was not known, the basic building blocks of DNA have
been known for many years. The basic elements of DNA had been isolated and
determined by partly breaking up purified DNA.
Nucleotides: The Building Blocks of
DNA
These studies revealed that DNA is
composed of only four basic molecules
called nucleotides, which are identical,
except that each contains a different
nitrogen base.
Each nucleotide contains a phosphate,
sugar (of the deoxyribose type), and one
of the four bases.
The four bases are adenine, guanine,
cytosine, and thymine.
Two of the bases, adenine and guanine,
are similar in structure and are called
purines. The other two bases cytosine
and thymine, are also similar and are
called pyrimidines.
The molecule is a double helix shape – a twisted rope ladder.
There are two distinct parts – the sides of the ladder and the rungs of the ladder.
Sides of the Ladder – made up of alternating groups of deoxyribose sugar and
phosphate groups. These groups are joined by a strong molecular (covalent) bond.
Rungs of the Ladder – consists of two bases joined by a weak hydrogen bond. The
base pairs are joined to the sugar and not the phosphate group. Base pairs will only
bond in one way A=T and C=G. This is called complimentary base pairing.
C. Base Composition of DNA
Following another experiment it waws discovered that th four types of nucleotides
were not present in equal amounts, and that the ratio was different for each species
studied. Several important generalizations were derived from this data.
1. For each species the number of
adenines approximates the
number of thymines, and the
number of cytosines
approximates the number of
guanines.
2. For each species, the number
of purines is approximately
equal to the number of
prymidines.
3. The number of A + T often
does not equal G + C, and the
ratio of A + T : G + C varies
between species.
4. The A + T / G + C ratio is the
same of all tissues of a single
species.
Scientists began to see that each
species had its own kind of DNA,
and that DNA could have a
complex structure.
D. The Double Helix
In 1953, Watson and Crick published a paper on the structure of DNA. Watson and Crick
proposed the double helix model.
The important features of their model of DNA, which resembled a twisted rope ladder,
were:
1. The DNA molecule consists of two right-handed helices (clockwise turns) coiled
around a common axis.
2. The sugar-phosphate backbone of each strand is the outer portion of the molecule.
3. The nitrogen bases extend inward and are at right angles to the long axis of the
strand.
4. The two strands are held together by weak bonds (hydrogen bonds) between
nitrogen bases.
5. The pairing of bases occurs only between A and T, and C and G.
Watson and Crick pointed out that although the stands are not identical, they were
complimentary.
If you are given one strand of the DNA you are able to identify the second strand.
ACCGTACGTACCGGTACATTAGGCCTACGG
Given the sequence of nucleotides in one strand, the sequence in the other is fixed.
You will recall from your study of cell division, that a copy of the cells “genetic
blueprint”, the DNA, is made in the second or synthesis stage of interphase. If the DNA
molecule were “unzipped” at the weak hydrogen bonds, which hold the nucleotides
together, it would be relatively simple to make a copy of the DNA molecule. As the two
original sides separated, each could then act as a template. Each nucleotide in the
template would match up to its complimentary partner, A with T, and C with G. The
result would be two DNA molecules identical to the original double helix. The variation
of bases sequence is key to storing information on the DNA molecule.
Knowing this information we are able to determine the percentage of all the nitrogen
bases once we are provided with one.
A = 25%
C=
T=
G=
T=?
C = 15%
G=?
A=?
Thought Lab – DNA Deductions
Procedure
1. Imagine that you are analyzing a DNA sample from the liver tissue of a newly
discovered species of mouse. Use the information in the table below to complete the
nucleotide composition of your sample.
Nucleotide
Presence in DNA sample (percent)
adenine
cytosine
guanine
thymine
31
2. Draw a linear stretch of a double-stranded DNA molecule about 20 base pairs long,
with a nucleotide composition that corresponds (as closely as you can) to the
nucleotide composition of your sample. Use solid lines to show chemical bonds and
dotted lines to show hydrogen bonds.
Analysis
1. Explain what you would expect to find if you compared the nucleotide composition
of your DNA sample with the nucleotide composition of a second DNA sample from
the muscle tissue of the same mouse.
2. Would the nucleotide composition of your original DNA sample be different from the
nucleotide composition of a tissue sample from the gametes of the same mouse?
Explain your answer.
3. Would the nucleotide composition of your original DNA sample be different from the
nucleotide composition of a tissue sample from the liver of a deer? Explain your
answer.
Genetic Timeline Research Project
Research the role that four or five scientists played in determining the structure and
function of DNA. Web links related to this chapter can be found at
www.albertabiology.ca. Go to the Online Learning Centre, choose the Student Edition
and follow the links to Chapter 18.
Using the names and contributions of the individuals you researched, create a timeline
flowchart. Write a reflection to explain why you chose these specific individuals. In your
opinion, how are their contributions important to our understanding of the DNA
molecule?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
E. Replication of DNA
As you will recall from your study of cell division, the genetic material of the cell must
be replicated or copied before the actual process of cell division can take place.
According to the model of the DNA molecule proposed by Watson and Crick, the two
stands can be “unzipped.” This would permit each single strand to act as a template for
new complimentary strand. A must pair with T and C must pair with G, but what happens
next? Do the original stands reunite? Or does each molecule of DNA have one original
strand and one new strand?
After several experiments the results support what is called the “semiconservative
replication model” of DNA. Each original strand must be paired with a new,
complimentary strand, keeping the density of the DNA constant at an intermediate level.

As with most cellular reactions, there is an enzyme responsible for DNA
synthesis. It catalyzes the formation of the sugar-phosphate bond between
adjacent nucleotides. It is called DNA polymerase since it is an enzyme that
makes a polymer or chain.

The process of DNA replication requires some energy, some preexisting DNA to
act as a template, a supply of the four nucleotides, DNA polymerase and several
other proteins and enzymes. Some of these enzymes are involved in controlling
the initiation of the replication process. Other enzymes assist with the unwinding
of the double helix or maintaining its structure.

High-energy triphosphate molecules, similar to ATP supply the energy for the
numerous reactions. Energy is released to power a reaction when a phosphatephosphate bond is broken.

The replication process takes place only at the point where the DNA double helix
separates. This is called the replication fork.

The template DNA dictates the sequence of nucleotides which will be linked to
each other with the assistance of DNA polymerase.
1. DNA helicase opens the double helix.
2. Proteins bind to the DNA to keep the two strands separate.
3. RNA primers are attached to the template strands.
4. DNA polymerase synthesizes the new DNA strands. The leading strand is synthesized
continuously, and the lagging strand is synthesized in short fragments. DNA polymerase
III adds complementary nucleotides in the 5′ to 3′ direction, using single-stranded primers
as starting points. One nucleotide is attached to the next by bonding the phosphate on
the 5′ end of the new nucleotide to the hydroxyl group on the 3′ end of the last nucleotide.
F. Initiation of DNA Replication
DNA replication begins at the replication origin, a specific nucleotide sequence that the
enzyme helicase can bind to on the DNA. The helicase enzyme cuts (cleaves) the DNA
and unravels part of the double helix. The oval-shaped area created by the unwound
double helix is called the replication bubble, and at each end of this oval is a Y-shaped
area called the replication fork.
G. Elongation and Termination
Elongation of the new DNA strand occurs
when the enzyme DNA polymerase adds
nucleotides to the template strands inside
the replication bubble. An RNA primer
must first be constructed by the enzyme
primase before DNA polymerase can do its
job. This is because DNA polymerase can
only add nucleotides to an existing free 3’
hydroxyl end of a nucleotide chain. Once
the primer is in place, DNA polymerase is
able to attach a nucleotide to the free 3’
hydroxyl end of the primer.
You can see the –OH (hydroxyl group) on
carbon 3’ in the figure to the right. DNA
polymerase then removes the RNA primer.
H. Detailed Process
1. The hydrogen bond between bases splits and the two strands become “unzipped”
by the enzyme helicase.
2. RNA primers initiate the formation of new sections of DNA.
3. New nucleotides are attached by DNA polymerases III
4. RNA primers are removed by DNA polymerases I (replacing with DNA instead
of RNA)
5. Ligase joins any gaps between sugar-phosphate molecules.
6. When complete, 2 identical DNA molecules are present.
DNA polymerase II proofreads the new strand looking for mismatched pairs to fix.




The two complimentary
strands are joined
together in the opposite
directions. One strand is
in the 3’ to 5’ direction
while the complimentary
strand is in the 5’ to 3’
direction.
Since DNA polymerase
can only add nucleotides
in the 5’ to 3’ direction,
only one strand can be
added to continuously.
This stand is called the
leading strand.
The other strand of DNA
is called the lagging
strand and must be
replicated in short
segments called Okazaki
fragments.
These fragments will then
be spliced (glued)
together by an enzyme
called DNA ligase.
Multiple primers are needed on the lagging strand. Eventually, DNA polymerase will
remove the RNA primers and fill in the space to attach the neighboring DNA stands.
DNA polymerase is also responsible for proofreading as each nucleotide is added to the
new strand. DNA replication stops when the new completed DNA stands separate from
one another. This is called termination.
I. Recombinant DNA
This is the technology of taking genetic material from one organism and placing it in
another organism. This may also be called gene splicing or genetic engineering. Enymes
have been discovered which will cut apart DNA (restriction enzymes) and will glue
DNA together (ligase enzymes). This has become a multimillion dollar industry in
biotechnology. One example is insulin being produced genetically by E. coli bacteria.
Glossary
Antiparallel: describes the property by which the 5’ to 3’ phosphate bridges run in
opposite directions on each strand of nucleotides in a double-stranded DNA molecule
Chargaff’s Rule: in any sample of DNA, a constant relationship in which the amount of
adenine is always approximately equal to the amount of thymine, and the amount of
cytosine is always approximately equal to the amount of guanine
Complementary base pairs: refers to the hydrogen bonded, nitrogenous base pairs of
adenosine and thymine, and of cytosine and guanine in the DNA double helix
DNA: deoxyribonucleic acid (DNA), a double-stranded nucleic acid molecule that
governs the processes of heredity in the cells of all organisms: composed of nucleotides
containing a phosphate group, a nitrogenous base and deoxyribose
Double-helix: spiral shape most commonly associated with DNA, made up of two long
strands of nucleotides bound together and twisted
DNA ligase: enzyme that splices together Okazaki fragments during DNA replication of
the lagging strand, or sticky ends that have been cut by a restriction endonuclease
DNA polymerase: an enzyme that slips into the space between two strands of DNA
during replication to add nucleotides in order to make complementary strands
DNA replication: the process of creating an exact copy of a molecule of DNA
Elongation: the process of joining nucleotides to extend a new strand of DNA; relies on
the action of DNA polymerase
Genome: The sum, or all of the DNA carried in an organism’s cells
Lagging Strand: the strand that is replicated in short segments during DNA replication
Leading strand: that strand that is replicated continuously in DNA replication
Okazaki fragments: short nucleotide fragments synthesized during DNA replication of
the lagging strand
Primase: enzyme in DNA replication that forms a primer which is used as a starting
point for the elongation of nucleotide chains
Replication bubble: oval-shaped, unwound area within a DNA molecule that is being
replicated
Replication fork: during DNA replication, Y-shaped points at which the DNA helix is
unwound and new strands develop
Replication Origin: specific nucleotide sequence where replication begins
RNA primer: short strand of RNA that is complementary to a DNA template and serves
as a starting point for the attachment of new nucleotides
Semi-conservative: term used to describe replication where each new molecule of DNA
contains one strand of the original complementary DNA, and one new strand, conserving
half of the original molecule
Termination: the completion of the new DNA strands and the dismantling of the
replication machine
The DNA Story
For each of the following statements, circle True if you feel it is correct, or False if you
believe it is incorrect. For each one that is false, write a correct statement in the space
provided.
1. DNA is the basic unit of heredity in eukaryotes.
True or False
2. Thymine is a nitrogen base found in DNA but not in RNA.
True or False
3. DNA replication is conservative.
True or False
4. Hershey and Chase determined that protein was responsible
for carrying genetic information.
True or False
5. Chargaff determined that adenine and cytosine were likely paired
together, while thymine and guanine were paired together.
True or False
6. A nucleotide consists of a five-carbon sugar, a nitrogen base, and
a phosphate group.
True or False
7. In DNA replication, the leading strand is replicated in short
segments called Okazaki fragments.
True or False
8. Each end of a double stranded DNA molecule contains a 5’ end
on one strand and a 3’ end on the complementary strand.
True or False
9. Watson and Crick were the only people responsible for
determining the physical structure of DNA.
True or False
10. A DNA sample that contains 34% adenine nucleotides will
contain 16% cytosine nucleotides.
True or False