Project Chimera will require between 20 and 30 hours to solve and complete with a
combination of class time and home work.
OBJECTIVES:
After completing this assignment, students should be able to:

understand the importance of DNA in the manufacturing of cellular proteins
(protein synthesis).

demonstrate knowledge in understanding the concepts of protein synthesis.

explain and show how DNA is used to manufacture proteins.

acquire a working vocabulary of terms related to molecular genetics and
protein synthesis.

write two scientific essays relating the theories and applications of molecular
genetics.

decode strands of DNA to determine possible characteristics based on protein
analysis.

create a three dimensional model to represent the decoding of DNA sequences.

create a representative diorama showing the biome that your model animal
will inhabit.

relate the importance of the gene pool to the survival factor within a prescribed
habitat.

demostrate how DNA and molecular genetics relate to evolution
1
DIRECTIONS:
(NEATNESS IS CRITICAL TO THE SUCCESS OF YOUR PROJECT)
SCENARIO
You are a research scientist in charge of a top secret molecular genetics project, code
named "PROJECT CHIMERA". The primary goal of this project is to create a DNA
database that encodes for proteins that govern the general characteristics of animals to
ensure that they are best adapted for their environment which will allow them the best
chances for survival. However, you believe that someone else knows about your
research and is trying to sabotage your results and terminate the project. There is good
evidence that someone has broken into the genetics laboratory and has altered or even
stolen your secrets. You order an investigation and determine that, indeed, there has
been a break-in. Someone has broken the genetic code and has removed Strand B
from your experimental model. You realize that with Strand A you should be able to
successfully recode Strand B. Hopefully, the saboteurs have not made any further
attempts to alter the strand.
Your job, as head genetics researcher, is to recode Strand B from Strand A and then
determine all of the characteristics of your model animal. Only then, will you be able
to determine if the saboteurs were successful.
You should be able to complete this project by following explicitly the following
directions below:
[ 1. ] At the end of this lesson you will find the complete DNA sequencing of Strand
A including all of the exons and introns. Your first task is to remove all of the introns
so the remaining exon nucleotides will be functional in manufacturing the correct
proteins. To simplify matters for this laboratory investigation there are only three
different introns. The nucleotide sequences for each of these introns are as follows:
INTRON 1: TACAAATACAGAAATACAGAA
INTRON 2: TACCCACTCGCC
INTRON 3: TACCGCCTCTACAAAACT
Remove all of the introns from the original DNA sequence. Make a list of all of the
introns that were stripped out of the original sequence and title it: "INTRON'S
REMOVED". This list should show the INTRON NUMBER (i.e. Intron 1, Intron 2,
or Intron 3) and the correct sequence that the introns were removed (i.e. Intron 2 Intron 3 - Intron 2 - Intron 1 - etc.) Construct your list so each Intron is listed on a
separate line. Your completed list should be submitted with your final project.
2
[ 2. ] Once the introns have been removed, use the exons to write the exact nucleotide
sequence on Strand A of your double helix molecule. Make sure that you copy the
order exactly and that all introns have been stripped out. Make sure that the
nucleotides follow the double helix and coil from side to side down the DNA double
helix. Each nucleotide should be written so it is centered on each chemical bond. Do
not write them in between the lines on the spaces. For example, they should look like:
-G or -T.
[ 3. ] Now that you have completed Strand A, recode Strand B according to the
concepts of DNA replication. Write the complementary base pair on Strand B. For
example, AGC on Strand A becomes TCG on Strand B. Write one nucleotide letter
per chemical bond line. The nucleotide letter should be at the center of each chemical
bond line. Make sure that you connect the nucleotides on Strand A to the nucleotides
on Strand B with the correct amount of hydrogen bonds. Draw in the hydrogen bonds
between the complimentary base pairs using dotted lines.
[ 4. ] Once the DNA double helix is complete you will transfer this information to the
"PROTEIN SYNTHESIS WORKSHEET". Copy Strand A onto the worksheet one
nucleotide at a time centered on the chemical bond line. For example write AGC one
letter per chemical bond on the DNA column. Make sure that each nucleotide is
centered on the chemical bond line. When you have completed Strand A, do the same
for Strand B. Make sure that you fully label all of your work with Strand
identification and page number so that you will not get the work for Strand A and
Strand B mixed up at any point. That would be disastrous to your results.
[ 5. ] After you have completed copying the DNA nucleotide order, check it one more
time to make sure that it is correct. If there is a single error in your DNA chain all of
your hard work and results will probably be incorrect. It is best to recheck your work
at this time.
[ 6. ] Your DNA message is now ready for decoding into mRNA, a process called
transcription. Using the "PROTEIN SYNTHESIS WORKSHEET" decode each
DNA nucleotide into its mRNA complement. For example, C in DNA language
becomes G in mRNA language and vise-versa while T becomes A and A becomes U
since there is no T in mRNA language. To go back to the original example, AGC in
DNA will become UCG in mRNA. As each group of three nucleotides in DNA is
called a triplet, each group of 3 nucleotides in mRNA is referred to as a codon. Work
through all of the triplets in both strands and translate them into the correct codons.
[ 7. ] The mRNA message can now leave the nucleus and travel through the
endoplasmic reticulum to the ribosomes which are the actual sites of protein
synthesis. Here the mRNA codon will be translated into atRNA anticodon. The tRNA
anticodon is able to attach to a specific amino acid. To show this on your model write
the tRNA anticodon next to the mRNA codon and place a small bracket around the
three anticodon nucleotides. At the point of the bracket write the correct amino acid.
3
The correct amino acid can be interpreted by using the "mRNA Codon Translation
Sheet". Locate the first letter in the first base column, the second letter in the second
base column and lastly the third letter in the third base column. You should now be
looking at a single amino acid. Write the amino acid code next to the bracket. For
example the UCG mRNA codon will be translated to an AGC anticodon attached to
the amino acid Serine. Remember, you use the mRNA codon when you look up the
amino acid, not the tRNA anticodon. Most amino acids are written using the first
three letters of their name. For example: Phenylalanine= Phe, Leucine= Leu,
Tyrosine= Tyr, etc. However, there are a few exceptions as follows: Tryptophan=
Tryp, Isoleucine= Ileu, Asparagine= AspN, and Glutamine= GluN. Use these Amino
Acid codes on your worksheet.
[ 8. ] When you have completed all of the Amino Acids, search both strands to locate
the correct amino acid sequences that will code for the proteins that will represent the
characteristics of your animal. The sequences must be absolutely identical.
[ 9. ] When you locate a protein, draw a box around the entire amino acid chain using
a colored pencil or pen and then label which protein you have located such as
PROTEIN 7A or PROTEIN 11B, ETC. and its characteristic.
[ 10. ] Sometimes proteins can be suppressed, masked, or inhibited by the presence of
certain sequences of nucleotides. To show how this works in this project there is one
inhibitor sequence. When this sequence precedes a sequence that codes for a protein
that protein is inhibited and is not expressed. It is as if the protein didn't exist at all
and the animal will not possess the inhibited characteristic. Make sure that you check
each protein for the presence of an inhibitor sequence. If you find an inhibitor
sequence, make sure that you highlight or box in that sequence with a different color
on your worksheet. The inhibitor sequence is as follows: GGGAGTTGCCCA
[ 11. ] Make a separate list of all of the proteins that you have found along with their
characteristics. Write the amino acid sequence, the protein number and its
characteristic. This list should be titled "LIST OF CHARACTERISTICS" and
submitted with your final project. Take your "AMINO ACID CODES FOR
PROTEINS" form and highlight each of the characteristics that were expressed for
your animal. If the protein expression is inhibited, make sure that you state that fact in
your list and on your sheet. Make sure that this sheet is also submitted with your final
project.
[ 12. ] Once you have located all of the proteins and have complete the protein
characteristic list you are ready to construct a model of your animal. The model
should be three dimensional and not just a drawing or painting. It can be any size but
remember that you have to get it to school. Your model should clearly show all of the
characteristics that are coded. The model can be done in clay, plaster of Paris, paper
maché, or any other medium that you select to create your model. You cannot take a
toy, stuffed animal, or a doll and use it as your model. You must construct an original
4
model. The type of animal that you create is totally up to you. If a real animal exists
with all of these characteristics then you certainly may use that animal for your
model. However, if there is no real animal that exhibits all of the protein
characteristics then you will have to create one. You really can create your own
animal in either circumstance. The key idea is to show all of the DNA coded
characteristics. You may be creative with your animal but don't get carried away. The
characteristics are real so the animal should be realistic. You may take parts from
different animals and fuse them together to make your animal. Hence the name "The
Chimera Project". Each characteristic has a specific adaptation to a particular habitat,
biome, or mode of life. Animal adaptations enable an organism to be better fit in its
environment and allow the species a better chance of mating and survival. Remember
these concepts in the creation of your animal.
[ 13. ] A "Biome Spinner" spinner will be available in the class. When you are ready
for this part of the project ask to use the Biome Spinner. Give it a good spin. The
biome that your spinner land on determines the biome that your animal inhabits. You
will get only one good spin. When your biome is determined, enter your name and the
biome on the Biome List in the classroom. The importance of this lab is to show that
certain characteristics are better adapted to certain habitats and biomes. Now you
need to create a diorama for your animal so you will be able to see the animal in its
natural surroundings. Constuct a diorama using a shoe box or other type of box and
try to make it look like the natural surroundings of that habitat.
[ 14. ] Write an essay explaining whether or not each of the characteristics that your
animal possess is adapted to that biome that was selected by the Biome Spinner. The
more characteristics that is adapted to that biome the more successful that animal will
be in surviving and reproducing. Based on your proteins and their characteristics, you
should be able to comment on whether the saboteurs were successful in destroying
your project. Write a statement in your conclusion expressing whether or not you
think the saboteurs were successful. This essay should be titled and submitted with
your final project.
[ 15. ] Your second essay is an essay explaining the complete process of protein
synthesis. Use this project as a reference guide for citing examples in writing your
essay. Your essay should probably be 4 - 8 pages (that's single sided) in length as it
should discuss all aspects of protein synthesis and gene expression. Your essay should
be written so that you understand the concepts in your own words and that they are
not just copied out of a textbook. Make sure that your essay is organized and that it
flows and makes sense. You can use illustrations were necessary to help explain
certain processes.
[ 16. ] Make sure everything is neat, fully labeled, and stapled together in order of the
grading sheet. Your name should be on all of your written papers as well as on your
model. Your grading sheet should be the first page of your project!
5
[ 17. ] Take your original DNA helix sheet and cut out the double helix. Attach the
bottom of the first section to the top of the second section, the bottom of the second
section to the top of the third and so on until you have completed one long strand. Use
glue or scotch tape to secure the sections together. When you cut out each section,
make sure that you leave a small tab above and below each row so you can connect
them together securely and still see all of the individual nucleotides. This long DNA
double helix should be folded (accordion style) and put into an envelope. Close the
envelope with a paper clip and attach it to your final project. Make sure that your
name is on the envelope and helix.
6
THE PROTEIN SYNTHESIS ESSAY MUST:

be in the FHS Essay Format
CD - Concrete Details (Facts)
example - Protein Synthesis occurs in the cell.
CM - Commentary (Opinion or your experience)
example - It was interesting to use "toys" to demonstrate how protein synthesis
occurs to Ms. Antoine.

be 2-4 pages in length
Typed
Double Spaced
12 point font size
Standard font (i.e. New Roman Times (windows) Helvitica (Macintosh))
WRITTEN IN YOUR OWN WORDS!

include the following list of words and each word must either be in bold or
highlighted.

The words must be defined within the context of the essay. This DOES NOT
mean that you should have a formal list of definitions. On the contrary, the
definitions should appear as a natural adjunct in your explanation of the process
of protein synthesis.
DNA
RNA
tRNA
Ribosome
Nucleus
Translation
Exons
Introns
Inhibitor
Physical Trait Gene
Protein
Start Codon
Stop Codon
Transcription Amino Acids Polypeptide
Adenine
Thymine
Guanine
Cytosine
Anticodon
Chromosome
Peptide Bond Nucleotides
Cytoplasm
Uracil
HydrogenBond
Codon
Enzyme
Mutation
Different Sequence
Strand A
Strand B
Endoplasmic Reticulum
Complimentary
Nuclear Pore
Replication
Central Dogma |
Amino Acid Sequence
mRNA Sequence
tRNA Sequence
DNA Sequence
7
Paraphrase in your own words, what you did in step 1 through step 12 of the Chimera
Project packet.
Next, find the steps that occur in the cell (in the packet, a textbook or on the internet) that
match what you did in the steps.
If there are any differences, (there are many!) explain what they are.
THE EVOLUTION/ADAPTATION ESSAY MUST:

be in the FHS Essay Format
Introduction - Topic Sentence
Summarize Activity
i.e. recount the Scenerio
Identify the most important characteristics related to your specific Biome
survivability.
Catagorize your traits as either helpful or harmful
CD - Concrete Details (Facts)
Identify each trait or adaptation.
example - The animial has a genetic trait for long claws.
CM - Commentary (Opinion or your experience)
How does it increase or decrease your animals chance of survival (the # of
CM's are left to your own judgement, however you must be very convincing
in your presentation.)
example - The long claws are an important factor in increasing my animals'
chances for survival because the claws enable it to climb trees and kill prey
effortlessly.

be 4-8 pages in length

include answers to the following questions about your specific animal
What traits does your species have?
What does the trait do?
8
How could it help an animal survive in your particular biome?
How could it be harmful to an animals' survival in your particular biome?
What is this species’ wild habitat (e.g., desert, tropical rainforest, cover,
moisture, concealment/camouflage options, temperature ranges, barriers
from conspecifics)? (If specific information on a particular species is
unknown, provide information on closely related species/genus/family.)
How does the animal in the wild behave in response to changes in
temperature and weather?
What temperature/humidity range does it experience in the wild?
What are some self-maintenance/comfort behaviors (e.g., preening,
grooming, bathing, dust-bathing, wallowing, sunning, panting)?
Is there a seasonal molt/shed?
When is it most active (diurnal, nocturnal, crepuscular)? Why (e.g.,
predator avoidance)?
Does the activity pattern change seasonally?
Does the species in the wild inhabit primarily arboreal, terrestrial or aquatic
environments or does it switch between them at times?
What are the main threats to the animal in the wild?
What is it likely to be afraid of (e.g., conspecifics, humans)?
What different types of predators does it have to look out for in the wild?
Are there any anti-predator behaviors (e.g., broken-wing display)?
Where and how does the animal seek refuge in the wild from fearful
situations (e.g., loud noises like thunder)?
What does fearful behaviors look like?
What are its primary sensory modalities (e.g., sight, smell, sound) for
communicating with conspecifics, detecting predators and for finding food,
mates, or other social partners?
What is the social structure of this species (e.g., solitary, dyads, "harem,"
colonial, leks, polyandry)?
What is the average/typical group size?
9
What is the average distance between social group members and from
neighboring conspecifics?
Describe the primary social behaviors of this species (e.g., aggression,
courtship, affiliative, play).
Does the social structure change seasonally or throughout the animal’s life
(e.g., juvenile versus adult, bachelor groups)?
Does this animal defend territories?
Does it maintain a home range?
What is the size of the home range/territory?
Does this species migrate seasonally?
Are the animals' enemies consist of interspecific (outside its' species),
intraspecific (within its' own species) competitors or both?
How does the animal advertise its home range or territory (e.g., scent
marking, song)?
How does the animal attract a mate (e.g., displays, scent marks)?
Who displays?
Is there dimorphism?(visible differences between males and females e.g.
peacocks & lions vs. wolves & snakes)
During what time of the year does the animal birth its' young?
How long a gestation period does the animal have?
How many offspring are usually produced per pregenancy?
Where does the animal raise young (nest location/type, den)?
What materials does it use to build nests/prepare dens?
Are both sexes involved in rearing young?
Are the young precocial or altricial?
How are the young fed?
How does the animal locomote through its habitat? (e.g., swim, walk, climb,
fly)
What is the animal’s diet type [e.g., omnivore, carnivore,invertebrate eater
(terrestrial, aquatic), vertebrate eater (consumer or predator of herbivorous
vertebrates), piscivorous (fish eater, ovivorous (egg eater)herbivore,
nectivore(nectar feeder), arboreal(tree) folivore (leaf eater), frugivore(fruit
eater), gumivore, spermivore (seed eater), fungivore (fungus feeder), aquatic
herbivore, sap feeder, root feeder, bark/cambium/bole feeder,
10
flower/bud/catkin feeder or a carrion feeder, cannibalistic perhaps even
coprophagous (feeds on fecal material)] in the wild?
Is it a browser(leaf, stem eater) or grazer(grass, forb eater)?
Does diet change seasonally?
By age?
What does the animal feed on in the wild?
What variety of food does it need to eat?
What behaviors does it use to locate and procure the different types of food it
needs?
Does it use tools to obtain food?
Store/cache food?
Where does the animal sleep or rest?
Does that change seasonally?
What is the size and weight of the species? (e.g. height, length, weight, tail
length, horn length, height to shoulder)
What is the lifespan of the animal?
When does it reach sexual maturity?
What kind of weapons does your animal possess?
What kind of stealth does your animal possess?
Does your animal have good eyesight?
Any other considerations?
Biome Fact List
How many seasons does your biome experience?
Is there annual variation in your biomes' weather?
Is there annual variation in your biomes' day length? If so, how much? When
is the peak?
What is the annual average moisture of your biome? (e.g. snowfall &
rainfall)
Is there annual variation in your biomes' rainfall? If so, how much? When is
the peak?
What is the annual average temperature of your biome?
Is there annual variation in your biomes' temperature? If so, how much?
When is the peak?
Does this biome have potential for overcrowding? (e.g. competition for food
sources )
How many lakes are rivers exist in your biome?
How many mountains exist in your biome?
11
Are there any barriers in your biome that would impede your animals
movement?
What are the potential toxins that exist in your animals biome?
What are the potential mutagens that exist in your biome? Are they
significant to effect the DNA of your animal?
What kind of diversity of animal life exists in your biome?
Animal Fact List
List the different types of animals found in your biome. (the sizes are all
relative to each other)
Five mammals (small, medium & large)
Five reptiles (small, medium & large)
Five birds (small, medium & large)
Five amphibians (small, medium & large)
Five fish (small, medium & large)
Five insects (small, medium & large)
Plant Fact List
When is the sprouting season of the plants in your biome? (e.g. spring,
summer, fall, winter)
When is the flowering season of the plants in your biome? (e.g. spring,
summer, fall, winter)
When is the seed season of the plants in your biome? (e.g. spring, summer,
fall, winter)
What is the evaporation rate of the plants in your biome?
How much moisture is necessary before sprouting occurs?
What temperature is necessary before sprouting occurs?
How much water is lost through evaporation?
What is the maximum size of the plant?
What is the lifespan of the plant?
Is the plant gender specific? (e.g. asexual, male, female, both)
How many seeds does the plant produce? (e.g. sticky, dropping, drifting or
fruit)
What type of structure does the plant have? (e.g. tree, shrub, grass or
floating)
Does the plant produce nectar?
Is the plant deciduous or evergreen?
12
Evolution Adaptation Rubric
4
Decidedly Above
Standard
3
Slightly Above
Standard
2
Meets Standard
1

Clearly shows the inter-relationship of the environment
to the survival fitness of the organism.

Clearly shows a recognition that an adaptation can be
physical and behavioral.

Vocabulary is always used appropriately and terms are
always correctly defined.

Demonstrates high level of critical thinking in justifying
traits and its adaptive value

Shows recognition of the environment and its importance
to the survival fitness of the organism.

Shows a recognition that an adaptation can be physical
and behavioral.

Vocabulary, grammar & spelling is always used
appropriately and terms are always correctly defined.

Demonstrates an appropriate level of critical thinking in
justify traits and its adaptive value.

Shows recognition of the environment and its importance
to the survival fitness of the organism

Vocabulary, grammar & spelling is generally used
appropriately and terms are always correctly defined

Demonstrates a satisfactory level of critical thinking in
justify traits and their adaptive value

Shows recognition of the environment and its importance
to the survival fitness of the organism

Many vocabulary are used inappropriately and many
terms are incorrectly defined.

Demonstrates an inappropriate level of critical thinking
in justify traits and their adaptive value
Below Standard
13
Protein Synthesis Rubric

Demonstrates a complete understanding that physical
variations depend on gene expression.

Demonstrates a complete understanding of mutations and
how they form.

Completely defines all the vocabulary within the essay.

Complete listing of all the steps of protein synthesis

Uses all vocabulary, grammar and spelling appropriately.

.Demonstrates a complete understanding of mutations and
how they form.
3

Completely defines all the vocabulary within the essay.
Slightly Above
Standard

Complete listing of all the steps of protein synthesis

Uses all vocabulary, grammar and spelling appropriately.

Completely defines all the vocabulary within the essay.
2

Complete listing of all the steps of protein synthesis
Meets Standard

Uses most vocabulary, grammar and spelling appropriately.
1

Below Standard

4
Decidedly Above
Standard
Listing of some of the steps of protein synthesis
Uses some vocabulary, grammar and spelling appropriately.
14