TITOLO DELLA TESI:
ANNO ACCADEMICO 2010-2011
1











 uNK cell functional properties during pregnancy





69
2

3

Chemerin was identified as the natural ligand of the orphan G protein-coupled receptor ChemR23,
also known as chemokine-like receptor 1 (CMKLR1) (Meder, Wendland et al. 2003).
Chemerin was initially described as a chemotactic factor able to promote the recruitment of leukocyte populations expressing ChemR23 involved in innate and adaptive immunity, including immature plasmacytoid dendritic cells (DCs), myeloid DCs, macrophages, and natural killer (NK) cells, to the site of injury in several human inflammatory diseases, such as psoriasis and lupus.
Recently, it is emerging a more complex role for this molecule: chemerin can act not only as chemoattractant but also as an adipokine able to regulate adipocyte development and lipid and
carbohydrate metabolism (Zhao, Yamaguchi et al. 2011); moreover, recent reports also implicated
chemerin in vascular remodeling.
CHEMERIN STRUCTURE
Chemerin structure is unrelated to that of chemokines or other chemoattractant factors for
leukocytes (Bondue, Wittamer et al. 2011). It is predicted to assume a so-called cystatin fold
common to a set of extracellular proteins, which include cystatins type 2 (cysteine protease inhibitors), cathelicidins (precursors of bacterial peptides) and kininogen (precursor of bradykinin).
Defensins and cathelicidins are the two major families of mammalian anti-microbial proteins: they contribute to host innate anti-microbial defense by disrupting the integrity of the bacterial cell
membrane (Yang, Chertov et al. 2001). The chemerin primary structure is relatively divergent from
other cystatin-like fold and contains six cysteines instead of four, suggesting the existence of an additional disulfide bond. In addition to the cysteine pattern, the number and location of introns is highly conserved within the gene structure of chemerin, cathelicidins, cystatins and kininogen,
4

further demonstrating their evolutionary relationship (Allen, Zabel et al. 2007). The three-
dimensional structure of the protein was not described, but only two of the four β-strands of the cystatin fold and a long additional C-terminal α-helix were proposed, suggesting divergence from
the classical cystatin fold (Bondue, Wittamer et al. 2011).
Like cathelicidins and kininogens, also chemerin requires proteolytic processing in order to generate the bioactive form of the molecule. The requirement for proteolytic processing was made clear from the purification of bioactive material from natural sources and the expression of
prochemerin in recombinant systems (Wittamer, Franssen et al. 2003).
PROCHEMERIN PROCESSING
The chemerin precursor, prochemerin, is composed of 163 amino acids and it is converted in the biological active molecule following proteolytic cleavage of its 6 or 7 carboxyl-terminal amino acids, which lie outside the cystatin-like fold.
Prochemerin processing is performed extracellularly and the active chemerin product is stable in extracellular medium. Several proteases have been shown to activate chemerin, sometimes in a cooperative manner. The first proteases demonstrated to activate prochemerin are two neutrophil
serine proteases, elastase and cathepsin G (Wittamer, Bondue et al. 2005). Elastase is able to cleave
off 6 amino acids from the C-terminus and this cleavage results in the generation of the most active form of chemerin (21-157), while cathepsin G, by removing the 7 amino acids from C-terminus, generates a less active form of chemerin (21-156). Plasmin and tryptase cleave off 5 amino acids from the C-terminus, generating an inactive form of chemerin but the subsequent removal of carboxy-terminal lysine by carboxypeptidases N and B action can lead to the generation of active
chemerin (Fig.1) (Zabel, Allen et al. 2005; Du, Zabel et al. 2009). Moreover other proteases, such
as urokinase, tissue plasminogen activator (TPA) and factor XIIa were described as activators of
prochemerin, but the specific cleavage sites were not identified so far (Zabel, Allen et al. 2005). It
5

was also reported that proteases from human pathogens can activate prochemerin for example the
staphopain B, a cysteine protease from Staphylococcus aureus (Kulig, Zabel et al. 2007).
Furthermore, a number of proteases were shown to inactivate bioactive chemerin or process prochemerin into short inactive forms. Mast cell chymase is able to convert the bioactive chemerin
21-157 and 21-156 (but not prochemerin) into the inactive variant chemerin 21-154, while neutrophil proteinase 3 is able to process prochemerin (but not the bioactive chemerin forms)
generating the inactive 21-155 form (Guillabert, Wittamer et al. 2008).
These data indicate a very complex regulation of chemerin bioactivity, in which various proteases from inflammatory, coagulation and fibrinolytic cascades modify the balance between active and inactive forms of chemerin.
CHEMERIN EXPRESSION SITES
Prochemerin is highly expressed in liver, white adipose tissue and placenta but it is also present in skin, adrenal gland, all parts of the gut, pancreas, the airways and the kidney. Several cell populations were shown to contain prochemerin transcripts, to display chemerin immunoreactivity and to release chemerin; these include epithelial cells, endothelial cells, fibroblasts, chondrocytes
and platelets (Vermi, Riboldi et al. 2005; Du, Zabel et al. 2009; Luangsay, Wittamer et al. 2009;
Berg, Sveinbjornsson et al. 2010).
Once secreted, prochemerin circulates at high concentrations in the plasma (6-12nM) while not relevant levels of bioactive chemerin were observed in basal conditions. The main sources of plasma prochemerin are liver and adipose tissue. Prochemerin was recently reported to be stored in platelet granules and released after activation by thrombin, collagen or ADP in a partially activated
form (Du, Zabel et al. 2009). Prochemerin is also expressed in keratinocytes and induced by
tazarotene only when these cells and fibroblasts were allowed to form a tissue-like-3-dimensional
structure (Nagpal, Patel et al. 1997).
6

Bioactive chemerin is elevated in several tissues and fluids in inflammatory conditions. First isolated from inflamed biologic fluids, such ovarian cancer ascites and rheumatoid arthritis synovial fluids, chemerin was also found in skin biopsies obtained from nonlesional psoriatic skin or patient with oral lichen planus as well as from patients with systemic lupus erythematosus and psoriasis
(Wittamer, Franssen et al. 2003; Albanesi, Scarponi et al. 2009).
Figure 1. Chemerin activation
Chemerin is proteolitically activated by multiple serine protease-mediated pathways triggered by injury, inflammation, or infection. Adapted from: Zabel BA et al. J Biol Chem 2005.
CHEMERIN RECEPTORS
Chemerin effector functions are mainly attributable to its ability to bind to the seventransmembrane-G protein coupled receptor ChemR23. However, two other receptors were recently described to bind chemerin, GPR1 and Chemokine (C-C motif) receptor-like 2 (CCRL2), and they might mediate part of the properties of this molecule (Fig.2).
7

Figure 2. Chemerin receptors
The three chemerin receptors, ChemR23, GPR1 and CCRL2 are represented at the surface of cells, together with the main events triggered by ligand binding.
From: Bondue B, Wittamer V, Parmentier M., Cytokine & Growth Factor Reviews 2011
Structurally, ChemR23 appears to be more closely related to chemoattractant receptors such as the anaphylatoxin C3a and C5a receptors and formyl peptide receptors rather than to the members of the CC- or CXC-chemokine receptor families. The murine orthologue of human ChemR23 gene, originally termed DEZ , was cloned from mouse brain by PCR. Its expression in hematopoietic tissues, such as thymus, bone marrow, spleen, fetal liver and lymphoid organs was consistent with
its possible role in regulating leukocyte functions (Yoshimura and Oppenheim 2011).
Among leukocyte populations, abundant ChemR23 expression was detected in the monocytic lineage, including monocytes and macrophages, microglial cells, and myeloid (m) and
plasmocytoid (p) DCs (Vermi, Riboldi et al. 2005). Both in mDCs e pDCs ChemR23 expression is
down-regulated during maturation, being particularly expressed in immature DCs (iDCs). In
8

addition, between the NK cell subset only the CD56 low
CD16
+
NK cell one express ChemR23 on
the cell surface (Parolini, Santoro et al. 2007). Furthermore ChemR23 is not expressed by B and T
lymphocyte populations, granulocytes, Langerhans cells and platelets (Wittamer, Franssen et al.
2003). ChemR23 expression was also described in a growing number of non-leukocyte cell
populations, including preadipocytes and adipocytes, osteoclasts, condrocytes, skeletal muscle cells
and endothelial cells (Sell, Laurencikiene et al. 2009; Berg, Sveinbjornsson et al. 2010; Ernst and
Sinal 2010; Kaur, Adya et al. 2010). The expression of ChemR23 can be modulated by many
inflammatory stimuli. In monocyte-derived iDCs, ChemR23 mRNA expression was downregulated in response to a low concentration of lipopolysaccharide (LPS) but up-regulated in response to high concentration of LPS. The expression of ChemR23 mRNA in monocytes was further up-regulated in response to tumor necrosis factor (TNF) or interferon-

(IFN-

) (Arita,
Bianchini et al. 2005). Moreover, ChemR23 expression on NK cells has been shown to be down-
regulated following NK cell activation with IL-2 or IL-15 (Parolini, Santoro et al. 2007). ChemR23
is coupled to the Gi family of G proteins. ChemR23 stimulation results in the activation of phospholipase C, IP3 release and calcium mobilization, and activation of PI3K and ERK, in a
Pertussis toxin-sensitive manner. Invalidation of ChemR23 by an anti-ChemR23 monoclonal antibody abrogated the chemotactic activity of chemerin on all tested leukocyte populations demonstrating the absence of redundancy with other known or unknown receptors. Maximal
chemotactic responses were obtained for chemerin concentrations of 100pM to 1nM (Wittamer,
Franssen et al. 2003). The chemerin elicited chemotactic response was completely abolished after
treatment with pertussis toxin, demonstrating the involvement of the G i class of G proteins.
Chemotaxis involves the adhesion of cells to extracellular matrix components and it was demonstrated that chemerin promotes the adhesion of macrophages to extracellular matrix proteins and adhesion molecules in a dose-dependent manner, by inducing the clustering of VLA-4 and
9

VLA-5 integrins at the cell surface, leading to the adhesion of macrophages to VCAM-1 and
fibronectin respectively (Hart and Greaves 2010).
Besides chemerin, ChemR23 can bind resolvin E1 (RvE1), an endogenous lipid mediator derived from eicosapentanoic acid (EPA), that in leukocytes leads to anti-inflammatory signaling and
promotion of inflammation resolution (Arita, Bianchini et al. 2005).
GPR1 is an orphan G-protein coupled receptor structurally closely related to ChemR23. It was found as additional chemerin receptor in the frame of the development of a beta-arrestin recruitment
screening assay named Tango (Barnea, Strapps et al. 2008).
The Tango assay showed that GPR1 displays high affinity for recombinant chemerin protein with an EC
50
of 240 pM. Following agonist binding, GPR1 signals poorly in classical G protein mediated pathways, such as calcium mobilization and ERK1/2 activation, while internalizes
efficiently, thus suggesting that GPR1 could act as a decoy receptor for chemerin (Barnea, Strapps et al. 2008). GPR1 is not reported to be expressed by leukocyte populations, but it is expressed in
the central nervous system, skeletal muscle, skin and adipose tissue and mesangial cells (Shimizu,
Tanaka et al. 2010; Tokizawa, Shimizu et al. 2000). It was also found that GPR1 works as potent
HIV/SIV co-receptor in addition to CCR5 and CXCR4.
CCRL2 was recently described as a third chemerin receptor. Its expression was detected on almost all human hematopoietic cells including monocytes, macrophages, T cells (both CD4
+ and CD8
+
), monocyte-derived iDCs, NK cells, and CD34 +
progenitor cells (Galligan, Matsuyama et al. 2004).
The level of CCRL2 was increased on T cells in response to stimulation with anti-CD3 or IL-2, while on monocyte-derived iDC in response to LPS, LPS + INF-

, poly (I:C) or CD40L (Migeotte,
Franssen et al. 2002). CCRL2 was also reported to be up-regulated in lung macrophages and
epithelial cells following in vivo sensitization (Oostendorp, Hylkema et al. 2004). Chemerin binds
human and mouse CCRL2 with high affinity, but the binding of the ligand to the receptor does not seem to promote any signaling in the cells and does not induce its internalization.
10

This correlate with the atypical structure of CCRL2 that lacks the conserved DRYLAIV motif in the
second intracellular loop that is required for signaling of functional chemokine receptors (Dawson,
Lentsch et al. 2000). The most intriguing recent finding is the cooperation between CCRL2 and
ChemR23. In the study by Zabel et al, the authors showed that mouse CCRL2 was constitutively expressed on mast cells, and is able to bind to chemerin and to present this ligand to ChemR23, thus
leading to the activation of ChemR23 mediated signaling pathways (Zabel, Nakae et al. 2008).
CHEMERIN FUNCTIONS
Chemerin pro- or anti-inflammatory activities
Since chemerin was a chemotactic factor generated in inflammatory conditions acting on cells involved in innate immune responses, it was initially expected to behave as a pro-inflammatory agent. Recent data however have disclosed a more complex situation in which prochemerin appears to mediate either pro- or anti-inflammatory activities depending on the type of chemerin isoform produced, according to the disease model investigated.
Significant levels of active chemerin were found in tissues and fluids in inflammatory conditions, such as the ascitic fluids resulting from ovary cancer, liver cancer as well as in synovial fluids from arthritic patients, and ChemR23-expressing cells were demonstrated to be recruited in a number of chronic inflammatory diseases.
Circulating levels of chemerin are increased for example in ulcerative colitis and Crohn’s disease
(Weigert, Obermeier et al. 2010). In lupus erythematous (LE), a prototypic inflammatory condition
characterized by tissue accumulation of pDCs, chemerin is selectively expressed in the endothelium of dermal blood vessels and in the high endothelial venules (HEVs) of secondary lymphoid organs.
Interestingly, chemerin was found in the lupus skin lesions, suggesting that this chemotactic factor
could contribute to the recruitment in these inflamed sites of pDCs that express ChemR23 (Vermi,
11

Riboldi et al. 2005). More recently, chemerin was found expressed in proximal tubular cells and
lymphatic endothelial cells in the kidneys of patients with severe lupus nephritis, and chemerin
expression in these tissues correlates with the recruitment of ChemR23-expressing pDCs (De
Palma, Castellano et al. 2011). Similarly, chemerin expression was assessed in early psoriatic
lesions and prepsoriatic skin adjacent to active lesion, as well as by inflamed dermal endothelium
and biopsies obtained from patients with oral lichen planus (Albanesi, Scarponi et al. 2009).
Furthermore, in psoriatic patients increased levels of chemerin were also observed in the plasma
(Nakajima, Nakajima et al. 2010). It has been proposed a role for the ChemR23/chemerin axis in
the recruitment of pDCs, neutrophils or blood NK cells. Since immunohistochemical analysis of these pathologic tissues revealed that DC were occasionally associated with NK cells, chemerin has
been suggested as a key factor for the co-localization of NK cells and DC subsets (Parolini, Santoro et al. 2007).
Chemerin was also detected in a pool of synovial fluids from arthritic patients (Wittamer, Franssen et al. 2003). ChemR23 and chemerin proteins were also detected in chondrocytes by immunohistochemistry, and challenging isolated chondrocytes with recombinant chemerin in vitro led to activation of Akt/MEK/MAPK intracellular pathway. Interestingly, it was shown that chemerin is able to induce the production of pro-inflammatory cytokines and matrix metallo proteases (MMPs), such as IL-1β, TNF-α, IL-6, and IL-8 as well as MMP-13 and others MMPs by
human chondrocytes (Berg, Sveinbjornsson et al. 2010; Iannone and Lapadula 2011). Besides its
inflammatory role, it has been recently demonstrated that chemerin possesses also potent antiinflammatory properties that are absolutely dependent on prochemerin proteolytic processing.
A first evidence describing the anti-inflammatory effect of chemerin and its derived peptides on macrophages ex vivo and in a mouse model of zymosan-induced peritonitis was recently reported
(Cash, Hart et al. 2008). A series of peptides were designed, and only those identical to specific C-
terminal chemerin sequences exerted anti-inflammatory effects at picomolar concentrations. One of
12

these, chemerin15 (C15), inhibited macrophage activation to a similar extent as proteolyzed chemerin but exhibited reduced activity as macrophage chemoattractant. Intraperitoneal administration of C15 to mice before zymosan challenge conferred significant protection against zymosan-induced peritonitis, suppressing neutrophil and monocyte recruitment with a concomitant reduction in proinflammatory mediator expression. Importantly, C15 was unable to ameliorate zymosan-induced peritonitis in ChemR23
-
/
-
mice, demonstrating that C15’s anti-inflammatory
effects are entirely ChemR23 dependent (Fig.3) (Cash, Hart et al. 2008).
Figure 3. The regulation of the inflammatory response by chemerin
Mature active chemerin is generated from pro-chemerin via C-terminal processing by serine-proteases. (1)
Active chemerin directly activates cells by binding to ChemR23, resulting in cell migration and calcium flux.
(2) Active chemerin also binds to CCRL2 via its N-terminal domain and presents the C-terminal domain to
ChemR23 expressed on neighboring cells. (3) Processing of chemerin by cystein proteases generates the inhibitory peptide chemerin 15, which binds to ChemR23 and inhibits the generation of proinflammatory mediators in response to LPS/IFN-

. (Yoshimura T. And Oppenheim J. JEM Commentary 2008)
Chemerin: a new adipokine
Besides its role as chemotactic factor, chemerin was more recently described as an adipokine regulating adipogenesis and adipocyte metabolism. Initially it was demonstrated that adipocytes
13

express both chemerin and ChemR23 (Goralski, McCarthy et al. 2007; Roh, Song et al. 2007;
Bozaoglu, Bolton et al. 2007). Chemerin regulates adipose tissue functions in an autocrine/paracrine
manner through its binding to ChemR23. During differentiation of bone marrow mesenchymal stem cells into adypocytes, chemerin upregulation was shown to correlate with that of PPAR

, the master
regulator of adipogenesis (Muruganandan, Parlee et al. 2011). Chemerin synthesis and secretion is
increased by TNF-α and IL-1β in 3T3-L1 adipocytes, human primary adipocytes or mouse
adipocytes in vivo (Sell, Laurencikiene et al. 2009; Parlee, Ernst et al. 2010), through the activation
of NFkB and ERK1/2 pathway (Kralisch, Weise et al. 2009). Furthermore, chemerin expression by
adipocytes is also induced by free fatty acids, through the transcription factor SREBP2 (Bauer,
Wanninger et al. 2011).
Chemerin was also described to mediate mature adipocyte functions, by controlling the expression of crucial effectors of glucose and lipid metabolism, including the glucose transporter GLUT4, diacylglycerol acetyltransferase (DGAT2), or by mediating the synthesis of triglycerides, and the
adipokines leptin and adiponectin (Ernst and Sinal 2010; Goralski, McCarthy et al. 2007). The real
effect of chemerin on lipolysis is still uclear. Some results show a reduction of basal lipolysis in
response to chemerin in 3T3-L1 or primary mouse white adipocytes (Shimamura, Matsuda et al.
2009; Goralski, McCarthy et al. 2007). On the other hand, Roh et al suggest a stimulation of
lipolysis by chemerin in3T3-L1 adipocytes (Roh, Song et al. 2007). The effect of chemerin on
glucose metabolism is also controversial. Indeed it was reported both an increase (Takahashi,
Takahashi et al. 2008) and decrease (Kralisch, Weise et al. 2009) of insulin-promoted glucose
uptake. Recently it was also demonstrated that chemerin induces also insulin resistance in human skeletal muscle cells at the level of insulin receptor substrate 1, Akt, and glycogen synthase kinase 3
phosphorylation (Sell, Laurencikiene et al. 2009). Obesity is frequently associated with a chronic
systemic inflammatory state. Indeed, chemerin as an adipokine able to promote chemotaxis of most leukocytes found in adipose tissue from obese individuals, was considered as a potential link
14

between obesity and inflammation but this link has not been well established yet. It was also demonstrated in a number of studies that obese and type 2 diabetic have high levels of chemerin in serum, that positively correlate with body mass index (BMI), fasting glucose, fasting insulin,
triglycerides and total cholesterol, but negatively with HDL cholesterol (Ernst and Sinal 2010;
Bozaoglu, Bolton et al. 2007).
It was recently reported that adipokines might play a role in the pathogenesis of preeclampsia.
Among those, increased concentrations of the appetite-suppressive adipokine leptin have been found in preeclampsia which precedes the clinical onset of the disease. Since the adipokine impairs glucose metabolism and preeclampsia is associated with metabolic disease, H.Stepan et al. demonstrated that chemerin concentrations are upregulated in preeclamptic patients during and after pregnancy, but the physiological significance of chemerin upregulation in preeclampsia remains
still unclear (Stepan, Philipp et al. 2011).
Chemerin and angiogenesis
Angiogenesis is a complex process involving multiple critical steps such as endothelial cell migration, proliferation and capillary tube formation.
A recent work has shown that ChemR23 is expressed by human endothelial cells (EC) and that its expression is up-regulated by pro-inflammatory cytokines, such as TNF, IL-1β and IL-6. Kaur et al. have also demonstrated that chemerin promotes angiogenesis in EC in dose-dependent manner
significantly increasing proliferation, migration and capillary-like tube formation of EC (Kaur,
Adya et al. 2010). Chemerin was previously shown to activate MAPK pathway after binding to its
receptor, ChemR23 (Zabel, Zuniga et al. 2006). It was demonstrated that the angiogenic effects of
chemerin are dependent on ERK and p38 MAPK signaling pathways, since a significantly increase
in ERK and p38 phosphorylation status was observed after chemerin treatment (Bozaoglu, Curran et al. 2010).
15

Moreover, also Akt pathway that play a critical role in the angiogenesis is activated upon chemerin
stimulation (Dimmeler and Zeiher 2000). The angiogenic potential of EC is greatly enhanced by
extracellular matrix degradation, where gelatinases MMP-2/9 play a pivotal role. It was demonstrated that chemerin exposure also results in an increase in gelatonolytic activity suggesting
a potential causal relationship between chemerin induced MMP activity and angiogenesis (Kaur,
Adya et al. 2010).
16

The uterine mucosa is unique among mucosal tissues for the presence of a large population of NK cells, during both the menstrual cycle and pregnancy. This distinctive feature suggests that uterine
(u) NK cells may play a role in uterus-specific events, such as pregnancy and menstruation,
although their exact function is still poorly defined (Kitaya, Yamaguchi et al. 2007; Carlino, Stabile et al. 2008). Interestingly, the number of decidual (d)NK cells into the uterus drastically increases in
the first trimester of pregnancy when their frequency reaches 60-70% of decidual leukocytes. This dNK cell numerical variation has been mainly attributable to hormone-induced decidualization and
to changes in chemokine expression rather than to the embryo implantation (Croy, van den Heuvel et al. 2006).
Besides dNK cells, the remainder leukocyte populations are CD14 + macrophages, DC, CD4 + T cells, few CD8
+
T cells,

T cells and NKT cells. Unlike from other mucosal sites, B lymphocytes are very scanty and plasma cells are not a normal feature, indeed their presence is associated with endometritis.
As above mentioned, in humans NK cells are also detected in non-pregnant endometrium. Initially, numerical variations of endometrial (e) NK cells have been observed inside the uterine compartment throughout the menstrual cycle, with their number increasing from the mid-secretory
phase and reaching the maximal level in the late secretory phase (Fig.4) (King, Balendran et al.
1991; Whitelaw and Croy 1996).
The increased number of uNK cells present in the secretory phase of the menstrual cycle suggests that uNK cell proliferation and/or migration is regulated by progesterone. However, the lack of PR expression in uNK cells indicates that the influence of progesterone on uNK cell functions could be
17

mediated by factors released and/or expressed on other cell types susceptible to the action of this
hormone (Henderson, Saunders et al. 2003).
One mechanism by which progesterone may influence uNK cell number is through modulation of cytokine and/or chemokine expression by other cell types within the endometrium. The perivascular cells express PR during the secretory phase and hence are likely to be a major target of progesterone actions within the uterus. IL-15 is present at peak levels during the implantation window when it is expressed by the perivascular cells and mRNA for IL-15Rα also shows peak expression in the mid
secretory phase (Lobo, Huang et al. 2004). In vitro studies have shown that IL-15 expression is
positively regulated by progestins in endometrial stromal cells and it has been reported to selectively recruit CD16
-
NK cells from the peripheral blood (Kitaya, Yasuda et al. 2000). IL-15 has
also been shown to increase proliferation of dNK cells, which express IL-15Rα (Verma, Hiby et al.
2000).
Figure 4: NK cell accumulation in the uterus during menstrual cycle and pregnancy
Adapted from: Jones RL et al J Clin Endocrinol Metab 2004; Kitaya K et al J. Reprod. Immunol 2007 .
18

The absolute number of uNK cells present in endometrium increases after ovulation although the proportion in relation to other leukocyte subtypes remains constant (30%) across the menstrual cycle. It should be noted that recent data have suggested that uNK cells isolated from endometrium differ from those from deciduas in their expression of surface activating receptors, chemokine
receptors and cytokine and grow factors (Manaster, Mizrahi et al. 2008).
NK CELL LOCALIZATION IN THE UTERINE COMPARTMENT
Inside the uterine compartment uNK cells are present only in the stratum functionalis of the endometrium (the superficial layer that responds morphologically to hormonal stimuli and is shed during menstruation) and not in the basalis (the deeper one, from which the endometrium
regenerates postmenstrually) (Trundley and Moffett 2004). Decidualization of the human
endometrium begins in the midlate secretory phase of the menstrual cycle irrespective of whether or not blastocyst is present and continues in the event of pregnancy and is critical for successful
implantation (King 2000). The stromal compartment shows the most profound changes with the
cells becoming plumper, developing a myofibroblast-like phenotype and increasing production of
proteins such as prolactin, insulin-grow factor binding protein-1 and tissue factor (Daly, Maslar et
al. 1983; Cataldo, Woodruff et al. 1993). Production of extracellular matrix proteins including
laminin and fibronectin also increases (Irwin, Kirk et al. 1989). Progesterone is necessary for
decidualization and the uteri of mice lacking the progesterone receptor alfa (PR

) show a defect in
this uterine modification (Lydon, DeMayo et al. 1995).
Studies on non-pregnant endometrium have shown that eNK cells are distributed throughout the tissue and there is not consistent variability in the position of NK cells at different cycle days
(Manaster, Mizrahi et al. 2008).
During early pregnancy, dNK cells accumulate in the decidualized stroma, where they are mainly
found as single cells or aggregates around endometrial glands and spiral arteries (King 2000).
19

There is little information regarding the distribution of human dNK cells in the second trimester of gestation, since tissues from this stage are hardly ever available. dNK cells are in close contact with several cell components of decidual tissue, such as stromal and endothelial cells and invasive trophoblasts and thus are probably constantly exposed to their stimuli consisting of either membrane-associated factors or soluble factors, such as IL-15 and TGF-

, or trophoblast-derived soluble HLA-G. The unique properties of dNK cells probably result from intense communication with the neighbouring decidual cells, local cytokines and secreted hormones that create the special microenvironment of this tissue. uNK CELL PHENOTYPE
Unlike pbNK cells but similarly to other tissue resident NK cells, a great majority of uNK cells show high levels of CD56 and do not express CD16; however El Costa et al. have recently shown the presence of CD16
+
NK cells also in the uterine mucosa (El Costa, Tabiasco et al. 2009).
Thus, the majority of dNK cells are CD56 high
CD16
-
CD3
-
, resembling, at least in term of expression of these cell surface markers, the CD56 high
pbNK cell subset however, the expression level of CD56 on dNK cell is around five-fold more intensive with respect to the CD56 high
peripheral blood counterpart. eNK cells share a similar phenotype but are characterized by a CD56 expression level intermediate between dNK cells and pbNK cells.
Moreover, it has been clearly demonstrated that first trimester human dNK cells exhibit a unique transcriptional profile. Gene expression comparison of dNK cells versus the two pbNK cell subsets
has showed that a significant number of genes are over-expressed in dNK cells (Koopman, Kopcow et al. 2003).
Detailed phenotypic and functional analysis of dNK cells indicate that they are a unique population, distinct from each NK cell subset circulating in the peripheral blood (Fig.5).
20

Like human pbNK cells, dNK cells express the CD2 antigen while lack the expression of CD57;
they also express both activating and inhibitory receptors for MHC I (Verma, King et al. 1997;
King 2000) although dNK cells have a different KIR repertoire compared to the peripheral blood
counterpart, suggesting that KIR expression is modulated within the uterus. Like the CD56 high pbNK cells, dNK cells express high levels of CD94/NKG2A. Furthermore, dNK cells, differently from CD56 high
pbNK cells, express the activation markers CD69 and HLA-DR, indicating that dNK cells have already become activated in situ. On the other hand, dNK cells resemble CD56 low
pbNK cells in the expression levels of the KIR receptors CD158b and KIR3DL1 and in the high granular cellular content. The whole dNK population express high levels of NKp46-, NKG2D-, 2B4- and lower levels of NKp30-, NKp44- and NKG2C-activating receptors. NKp44 expression is a further indication of their activated status, because this marker is only expressed on activated pbNK cells.
Interestingly, most of dNK cells are CD160
- whereas a minor subset appear CD160
+
, contrasting again with pbNK cells. Most dNK cells express KIR2DL4, whereas a distinct subset exhibit
KIR2DL1, KIR2DL2/3, KIR3DL2 and ILT2 (Le Bouteiller, Siewiera et al. 2011; El Costa,
Casemayou et al. 2008; Gonen-Gross, Achdout et al. 2003)). dNK cells express also the inhibitory
collagen receptor LAIR-1 (Apps, Sharkey et al. 2011).
dNK cells, differently from pb CD56 bright
NK cell subset, also express several cytokine receptors, such as IL-15R, IL-2R

, and IL-2R

but lack the expression of IL-7R

. In humans, several studies have shown that dNK cells, as well as eNK cells, express the cell proliferation-associated nuclear marker Ki-67, suggesting that, at least in part, they proliferate in situ in the endometrium.
Moreover, the rate of Ki-67 positive eNK cells was higher in the secretory phase than in the
proliferative phase (King, Balendran et al. 1991).
A large number of studies indicate that first trimester human dNK cells express also a distinct pattern of adhesion molecules and chemokine receptors as compared to both CD56 high
and CD56 low peripheral blood counterparts. dNK cells, differently from CD56 high
pbNK cells, lack the expression
21

of L-selectin (CD62L). In regard to integrin expression, dNK cells exhibit high levels of

E

7,

1

1,

X

2,

D

2, whereas do not express the laminin receptor

6

1. In addition, they also display the

5 integrin subunit and the tetraspan 5, CD151 and CD9 tetraspanins that are
constitutively associated with integrins and modulate integrin function (Dietl, Ruck et al. 1992;
Slukvin, Chernyshov et al. 1994; Burrows, King et al. 1995; Koopman, Kopcow et al. 2003).
In regard to the chemokine receptor profile, dNK cells exhibit higher levels of CXCR3, lower levels of CXCR4, and very low or undetectable levels of CXCR1 or CXCR2, CX3CR1 or CCR1, 2, 3, 5,
6, 7, as compared to CD56 high
CD16 low
or to the CD56 low
CD16 high
pbNK cells (Hanna, Wald et al.
2003; Sentman, Meadows et al. 2004; Wu, Jin et al. 2005; Carlino, Stabile et al. 2008).
Figure 5. Phenotypical differences between decidual and pbCD56 bright NK cell subset dNK cells express a distinct cell surface receptor pattern with respect to pbCD56 bright NK cells. Major differences have been found in the expression of adhesion molecules and chemotactic receptors (such as
CD9, L-selectin, αεβ7, CD49a) but also among the inhibitory (ILT-2) and activating (NKp44) ones.
22

dNK cells are also positive for the cytotoxic molecules perforin and granzymes A and B, and these cytotoxic mediators are expressed in dNK cell at higher levels with respect to the pbNK cell counterpart. uNK CELL FUNCTIONAL PROPERTIES DURING PREGNANCY
Cytotoxicity
Although uNK cells express activating receptors and have been shown to be endowed with an intact
cytolytic machinery, including perforin, and granzymes A and B (Tabiasco, Rabot et al. 2006), they
are poorly cytotoxic. There are evidences indicating that uNK cells exhibit a defective secretory pathway as they fail to polarize the microtubule-organizing center and the cytolytic granules toward
the synapse (Kopcow, Allan et al. 2005). However, if properly activated these cells can kill target
cells, thus suggesting that they can promptly become capable of attacking fetal and maternal tissues during infection and inflammation.
One of the potential role of uNK cells, expecially during pregnancy, but also in non-pregnant endometrium, is to protect the tissue from infections, since endometrium is potentially exposed, even in the non-pregnant state, to a range of foreign antigens, including spermatozoa, and this unusual mucosal tissue is devoid of plasma cells and contains very few B cells.
Recently it has been demonstrated that uNK cells express granulysin (GNLY), a novel cytolytic protein capable of acting against a variety of tumor cells and microbes, but not normal human cell.
GNLY requires perforin as a co-factor to enter the cell and kill intracellular pathogens. Besides its cytolytic properties, GNLY has been also found to be a chemoattractant and a pro-inflammatory molecule. In early pregnancy and second trimester placentas, the expression of GNLY mRNA increases further, while its expression is downregulated at term placentas (37-40 weeks).
In normal pregnancy, the implanted embryo constitutes a hemiallograft but remains spared from attack by the maternal immune system and many immunological mechanisms for tolerance of semi-
23

allogenic embryos have been proposed. First, this phenomenon could be a result of inhibitory interactions between the non classical class I MHC-molecules HLA-G and HLA-E and the inhibitory receptors expressed on dNK cells, ILT-2, KIR2DL4 and CD94/NKG2A . However, ILT-
2, the most dominant HLA-G binding NK inhibitory receptor is only expressed on 20% of dNK cells, and whether KIR2DL4 could interact with HLA-G, and inhibit NK cell activity is still
controversial (Apps, Gardner et al. 2008; Manaster and Mandelboim 2010). Vacca et al. provided
another possible explanation according to which, the cytotoxic activity of dNK cells is inhibited by the receptor 2B4, which delivers inhibitory signals that correlate with low or absent signalling
lymphocyte activation molecule-associated protein (SAP) expression in dNK cells. (Vacca, Pietra et al. 2006)
Moreover, the resistence of trophoblast cells to uNK cell lysis has also been ascribed to the ability of trophoblast cells to express of an inhibitor of Fas-mediated apoptosis (XIAP) during first
trimester pregnancy (Straszewski-Chavez, Abrahams et al. 2004). It has been demonstrated that
sHLA-G1 influences cytotoxicity-related intracellular signalling pathways in uNK cells. This includes a down-regulation of signal transducer and activator of transcription factor 3 (STAT3) and
perforin expression, in combination with reduced proliferation and cytotoxicity (Poehlmann,
Schaumann et al. 2006).
Immunoregulatory activity
Although dNK cells are poorly killers, they are able to secrete a wide array of cytokines, chemokines, and angiogenetic factors without stimulation, suggesting that they have undergone activation in the decidua.
Human dNK cell released cytokines include GM-CSF, TNF-

, leukemia inhibitory factor (LIF),
IFN-

and CSF-1. Furthermore, differently from pbNK cells, dNK cells express the
immunomodulatory protein glycodelin A (GdA) (Koopman, Kopcow et al. 2003). Although studies
24

on the action of GdA toward NK cells are still limited, it has been demonstrated that GdA induces
the secretion of cytokines such as IL-6, IL-13, and GM-CSF and chemokines from pbNK cells (Lee,
Chiu et al. 2010). It has been shown that dNK cells can also secrete several chemokines, such as IL-
8 and IP-10, that bind to their receptors on invasive trophoblast causing trophoblast migration
(Hanna, Goldman-Wohl et al. 2006). uNK cells were shown to be potent secretors of an array of
angiogenetic/vascular growth factors in the deciduas, such as VEGF, PLGF, and angiopoietin 2
(Fig.6).
Figure 6. Distinct functions for dNK cells with respect to their peripheral blood counterpart
Although dNK and pbNK bright cells share many functional properties, like reduced ADCC and citotoxicity potential, the former population is able to produce angiogenic factors important for the vascular remodeling during pregnancy, such as VEGF, PLGF, Ang-2, NKG5.
It is conceivable that through the release of cytokines and chemokines, dNK cells control extravillous trophoblast invasion, as well as the recruitment and functions of other immune cells
such as DCs and T lymphocytes (Moffett-King 2002; Hanna, Goldman-Wohl et al. 2006). In this
regard, a recent report demonstrates an intimate contact between NK cells and DC-SIGN
+
immature
25

DCs in human decidua of first trimester pregnancy, strongly suggesting the existence of an interplay
between these two leukocyte populations in this tissue (Dietl, Honig et al. 2006). It has been
suggested a possible scenario of NK cell-DCs cross-talk in which NK cells contribute to the maintenance of a DC tolerogenic phenotype through the release of GM-CSF and IL-10. There is a considerable interest in the role of cytokines in pregnancy, a bias towards type 2 cytokines
favouring successful pregnancy, while a type 1 cytokines are considered to be detrimental (Sargent,
Borzychowski et al. 2006). Moreover, it has been recently demonstrated that dNK cells, through the
cross-talk with particular myelomonocytic CD14+ cells, can mediate the induction of a subset regulatory T cells (Tregs) that is thought to play an important role in preventing fetal rejection. In particular following the interaction with decidual CD14+ cells, dNK cells secrete IFN-

which promote indoleamine 2,3-dioxygenase (IDO) expression in CD14+ cells; these “conditioned”
CD14+ cells, in turn, acquire the ability to induce Tregs by a mechanism that involve IDO and
TGF-

(Fig.7) (Vacca, Cantoni et al. 2010).
Recently, Manaster et al. showed that Notch is expressed by human dNK cells and that activation of
Notch by its ligands Delta1 or Delta4 results in the increased secretion of IFN-

by IL-15 activated
dNK cells (Manaster, Gazit et al. 2010). It was previously demonstrated that VEGF is able to
induce Delta4 expression in arterial endothelium (Liu, Shirakawa et al 2003); furthermore Delta4 was shown to be expressed in human endometrium, especially in the luminal and glandular epithelium and also in stromal cells (Mazella, Mizrahi et al 2008). It was hypothesized that VEGF
produced by dNK cells (Hanna, Goldman-Wohl et al. 2006) increases the expression of Delta4 in
the decidua, thereby leading to increased interaction between Notch on dNK cells and Delta4
(Manaster, Gazit et al. 2010). This results suggests the presence of an additional signal that
contributes to regulating dNK cell functions at fetal-maternal interface.
26

Figure 7. Cross talk beteewn dNK and immune cells in human decidua
dNK reside in close contact with particular myelomonocytic CD14+ (dCD14+) cells. The interaction between dNK cells and dCD14+ cells resulted in the production of IFN-γ, which promoted IDO expression in dCD14+ cells. IDO expression and TGF-b production by dCD14+ induce the generation of Treg cells and finally results in the suppression of T cell proliferation.
The ability of dNK cells to secrete a variety of cytokines suggests that dNK cells must be activated in the tissue, rather than inhibited, to exert their constructive roles at the fetal-maternal interface.
Indeed it has been shown that dNK clones expressing the activating receptor KIR2DS4 generated higher amount of IL-8, IP-10, VEGF and PLGF than clones expressing inhibitory receptors, such as
KIR2DL1. This suggests that activation of dNK cells reduces the risk of pre-eclampsia, through the
production of sufficient amounts of growth factors and chemokines by dNK cells (Table 2) (Hanna,
Goldman-Wohl et al. 2006).
Considerable effort has been recently devoted to understand the importance of NK cells in the control of pregnancy outcome. Accumulating evidence indicate that uNK cells significantly
27

contribute to maintenance of pregnancy (Moffett-King 2002; Croy, van den Heuvel et al. 2006).
Thus, it is conceivable that alterations in NK cell functional program can be responsible for implantation failure or other pregnancy-associated disorders, such as recurrent spontaneous abortions (RSA), infertility, and pre-eclampsia. Indeed, altered numbers and distribution of NK cells have been correlated to spontaneous abortion, in-vitro fertilization failure, and serious fetal
growth restriction (Dosiou and Giudice 2005). In addition, a shift in the profile of cytokines
produced by NK cells has been found associated with pre-eclampsia (Borzychowski, Croy et al.
2005).
Several evidences clearly suggest a pivotal role for uNK cells in the regulation of vascular remodeling and trophoblast invasion, however, which uNK cell functions are critical for successful pregnancy, have not been yet fully defined.
Vascular remodelling
Among their functions in ensuring a successful pregnancy, dNK cells has been shown to play a pivotal role in the angiogenetic process.
Pregnancy related angiogenesis is required for successful implantation, placentation and subsequent gestation in order to coordinate vascular development and adaptations on both sides of the maternalfetal interface. Specifically, several temporally distinct vascular processes occur enabling successful pregnancy to ensue. First, adequate uterine vascularity is needed at the time of implantation to provide a highly vascularized endometrium for implantation. Shortly after implantation, development and expansion of the placental villous vasculature is needed to facilitate transport of nutrients and oxygen to the embryo. Subsequently, remodelling of the maternal endometrial/uterine
vasculature is needed to accommodate the rapid growth demands of the embryo (Torry,
Leavenworth et al. 2007).
28

The early stages of angiogenesis are characterized by endothelial cell proteases production for degradation of basement membrane and extracellular matrix, endothelial cell migration and
endothelial cell division or proliferation and assembly of new vessels (Zetter 1998).
At present, the main factors considered to regulate angiogenesis in pregnancy are VEGF, PlGF,
ANGs (Charnock-Jones, Kaufmann et al. 2004) and hCG (Zygmunt, Herr et al. 2002). Among
these, VEGF-A represents the foremost factor in vascular development. VEGF transcription is induced by hypoxia-inducible factor-1 (HIF-1), and its action is mediated via two kinase receptor isoforms, VEGF-R1 (Flt-1), whose signaling is responsible for tube formation, and VEGF-R2
(KDR) that induces endothelial cell proliferation. PlGF protein is localized in trophoblast and vascular smooth muscle cells (VSMCs) and rises during the third trimester to shift the VEGF/PlGF balance, probably contributing to a change from the branching low-resistance villous capillaries to
the non-branching vessels prominent in late pregnancy (Valdes and Corthorn 2011). Human CG
directly stimulates angiogenesis through recruitment, proliferation, and migration of EC and smooth muscle cells (SMC), and promotes the interaction between EC and VSMC, furthermore hCG
stimulates the release of VEGF by human epithelial endometrial cells (Berndt, Blacher et al. 2009).
The increase in the coiling of endometrial arteries is one of the most important process during the first trimester of pregnancy. Spiral arteries modification comprises a complex sequence of events that convert the spiral arteries into thin-walled, highly dilated vessels, of minimum resistance, with loss of normal musculo-elastic structure. These changes are associated with unique homing and/or expansion of dNK cells.
Harris et al. (Harris 2011) demonstrated that uNK cells secrete a unique pattern of soluble factors
capable of destabilizing the vascular architecture, providing them with the means to initiate spiral artery transformation, to direct uNK-EVT cell interactions, and to reduce the ability of uNK cells to
induce vascular disruption (Lash, Robson et al. 2010). uNK cells also produce MMP-2, MMP-7 and
MMP-9 (Naruse, Lash et al. 2009), which degrade collagen IV, laminin and elastin and have been
29

implicated as mediators of decidual vascular remodeling (Smith, Dunk et al. 2009; Hazan, Smith et al. 2010).
In situ hybridization studies with non-pregnant endometrium localized mRNA for VEGF-C, PLGF
and Ang2 to eNK cells (Li, Charnock-Jones et al. 2001). VEGF-C, in parallel with uNK cell
number, peaks during the early and mid secretory phase of the cycle. Other studies have shown that unlike pbNK cells, dNK cells are a major source of VEGF-C, Ang1, Ang2, NKG5 and TGF-

1
within the placental bed (Hanna, Goldman-Wohl et al. 2006). The secretion of these factors
decrease with gestational age, when angiogenesis is almost completed, implicating dNK cells in promoting angiogenesis. In addition, Tie2 and VEGF-R2 were identified on vascular smooth
muscle in decidual spiral arteries (Lash, Schiessl et al. 2006).
The close encirclement of spiral arteries by dNK cells together with their ability to produce angiogenic factors have supported the idea that the major role of dNK cells is the control of
mucosal vascularization and placental development (Croy, van den Heuvel et al. 2006; Hanna,
Goldman-Wohl et al. 2006; Leonard, Murrant et al. 2006). Based on the ability of NK cells to
produce VEGF, it has been suggested that they act as guidance of endothelial tip cells toward implantation sites of trophoblast. In addition, uNK cells appear to be directly involved in initiating spiral artery structural changes.
The majority of evidence for uNK cells involvement in spiral artery transformation has come from a series of in vivo experiments of Croy and coworkers performed in mouse models. They demonstrated that in mice deficient in NK and T cells, females, that however retain fertility, have profound vascular alterations at implantation site, with spiral arteries more constricted, thicker walled and shorter than in control animals. Interestingly, restoration of the development of NK cells but not of T cells, results in restoration of dNK cells populations, fetal viability and reduction of
decidual abnormalities (Guimond, Wang et al. 1998), and IFN-

secretion is likely involved in this
action (Ashkar, Black et al. 2003).
30

In addition, a role of dNK cells in transient lymphatic drainage has also been hypothesized based on their ability to synthesize the lymphoangiogenic molecule VEGF-C and to the finding of excessive decidual edema in uNK cell deficient mice.
Taken together, these findings strongly support a role for dNK cells in spiral artery remodeling.
Trophoblast invasion
In humans, trophoblast invasion of uterine tissues and spiral arteries is essential for a successful pregnancy (Fig.8). This process must be tightly controlled, since excessive invasion can be associated with placenta accreta, while inadequate invasion with pre-eclampsia, some cases of fetal
growth restriction and preterm labor (Bulmer and Lash 2005). During human pregnancy, dNK cells
are found in close proximity to the implantation site, and their close contact with the infiltrating extravillous trophoblast suggest that they may play an active role in the regulation of trophoblast growth and invasion. Several mechanisms have been proposed to explain how dNK cells may exert this regulatory function.
Initially it was proposed that dNK cells could kill trophoblast in order to avoid excessive invasion; anyway, several works have underlain that dNK cells are very poor cytotoxic against trophoblast cells.
Central question is whether dNK cells can control the trophoblast invasion level by recognizing trophoblast ligands. A study in couples with recurrent spontaneous abortion as well as in random cases of abortion revealed that aborting women usually have a limited repertoire of inhibitory receptors of the KIR family, and that many of them lack inhibitory KIRs specific for fetal HLA-C antigens, suggesting that some spontaneous abortions are caused because of a limited maternal inhibitory KIR repertoire and a lack of maternal inhibitory KIR-fetal HLA-C epitope matching
(Varla-Leftherioti, Spyropoulou-Vlachou et al. 2005). Based on this finding, it has been suggested
that interaction between maternal KIR present on dNK cells and paternal derived HLA-C alleles
31

expressed by extravillous cytotrophoblast which are poorly stimulatory for decidual NK cells, may control the depth of invasion of trophoblast, although a functional basis for this hypothesis is still
awaited (Hiby, Walker et al. 2004).
Figure 8. dNK cell and trophoblast cell cross-talk dNK cells have an important role in the regulation of trophoblast invasion and vascular remodeling. Some of the mechanisms suggested for this regulation include chemokines and VEGF production. dNK cells can induce trophoblast migration through the secretion of IL-8 and IP-10. In the meantime, the trophoblast is involved in the accumulation of dNK cells by producing SDF-1.
An aternative hypothesis for dNK cell role in the regulation of trophoblast invasion is that, following recognition of trophoblast, dNK cells change their cytokine production profile, thus altering the trophoblast invasive behaviour since factors such as trophoblast metalloproteinase and
integrin expression can be influenced by the cytokines milieu at the implantation site (Trundley and
32

Moffett 2004). Furthermore, has previously said, dNK cells can induce trophoblast migration
through the secretion of IL-8 and IP-10 (Hanna, Goldman-Wohl et al. 2006). However, a direct role
of dNK cells in controlling trophoblast invasion is still controversial. In particular, it has been observed that trophoblast can extent onto the inner third of the myometrium where there are no NK
cells (Moffett and Loke 2006), and that in tubal ectopic pregnancy, NK cells are absent from the
fallopian tubal wall even in the site of trophoblast invasion, whereas the decidua basalis is full of
NK cells (Bulmer, Pace et al. 1988; Le Bouteiller and Piccinni 2008). Thus, further studies are
necessary to better elucidate the mechanisms governing this process.
Furthermore, also uNK cell properties can be modulated by the interactions with neighboring decidual cells. dNK cells are in close contact with invasive EVT that could regulate the function of uNK cells through the secretion of cytokines. In this regard, it was demonstrated that IL-32 mRNA is up-regulated in EVT and this cytokine is known to be able to stimulate its own release from
pbNK cells in a feedback loop and potently induces macrophages to secrete TNF-α and IL-8 (Conti,
Youinou et al. 2007). Apps et al. also demonstrated high expression in EVT of transcripts of
CLEC2D, the ligand for the NK cell activating receptor CD161 (NKR-P1A), thus suggesting new potential ligand/receptor interactions between EVT and NK cells during placentation. Another mechanism by which EVT may regulate the function of decidual leukocytes is through the secretion of LAIR-2, a protein closely related to LAIR-1, an inhibitory receptor binding to extracellular
matrix collagen, that is expressed on dNK cells (Lebbink, de Ruiter et al. 2006; Lebbink, van den
Berg et al. 2008). It was proposed that LAIR-2 secreted by invading EVT may increase decidual
leukocyte responsiveness by binding to collagen and thus blocking LAIR-1 specific interaction with
this extracellular matrix protein at the maternal-fetal interface (Apps, Sharkey et al. 2011). In
addition, it has been shown that purified HLA-G trophoblasts are able to bind the NKp44 receptor, suggesting that they express yet uncharacterized ligands for this specific NK cell activating receptor
(Manaster and Mandelboim 2008). Thus, it is possible that chronic stimulation of dNK cell
33

activating receptors by their ligands could affect the function of dNK cells resulting in their lack of cytotoxicity toward fetal cells and their enhanced ability to produce growth factors. uNK CELL ORIGIN
Which is the origin of uterine NK cells is still unclear: it has been suggested that they can derive from NK cell populations recruited from peripheral blood and/or other tissues, although self renewal of NK cell progenitors present in the uterus prior to pregnancy or recruited from other tissues cannot be excluded (Fig.9).
Figure 9. The origin of dNK cells
Whereas, pbNK cells mainly derive from a lymphoid common precursor in the bone morrow, the origin of dNK cells is still unknown. Three main hypotesis have been proposed: i) NK cell recruitment from peripheral blood or other tissues; ii) an NK cell precursor that once recruited in the uterus undergoes differentiation; iiii) proliferation and differentiation of a uterine resident NK cell precursor.
34

Much information on uNK cell development derives from studies in animal models, and in
particular in rodents (Croy, van den Heuvel et al. 2006) because endometrial human sampling is
obtained mostly from elective pregnancy terminations, and detailed time course studies cannot be performed.
Adoptive transfer of hemapoietic cells from uNK cell sufficient mice into mice deficient in
NK/uNK cells indicate that uNK precursor cells are present in fetal liver and thymus, and in adult thymus, bone marrow, lymph nodes and spleen, being lymph nodes and spleen the best sources of transplantable progenitors. Of interest, lymph nodes draining pregnant uteri fail to reconstitute uNK
cells, thus supporting the idea that precursor NK cells are retained into gestional uterus (Chantakru,
Miller et al. 2002).
Based on evidences in mice, it is clear that uNK cell development and maturation share several
aspects with NK cell development in the bone marrow (Di Santo and Vosshenrich 2006) but also
display distinctive tissue-specific regulation.
Mature uNK cells are found only in uteri undergoing progesterone-mediated decidualization, thus indicating that uNK cell maturation and proliferation is independent of conceptus tissues including
trophoblast cells (Ordi, Casals et al. 2006). However, although embryo-derived signals are not
required for recruitment of uNK cell precursors and differentiation, evidence obtained in conceptus-
free deciduatoma (Zheng, Ojcius et al. 1991) or in ectopic pregnancies (Ordi, Casals et al. 2006)
indicates that conceptus-derived signals are required for normal uNK cell life span, as they decline much faster in these situations.
Like for NK cells developing in the bone marrow, several evidences indicate that signals provided by decidualized stroma, such as IL-11 and IL-15, control uNK cell development and functional
differentiation (Kitaya, Yasuda et al. 2000; Verma, Hiby et al. 2000; Zourbas, Dubanchet et al.
2001; Ain, Trinh et al. 2004). In particular, mice lacking genes for the common

chain, common
 chain or IL-15 receptor display severe deficiency of uNK cells, suggesting that IL-15 receptor
35

signaling is essential for uNK cells differentiation (Croy, Esadeg et al. 2003; Croy, He et al. 2003).
At present the information on the development of human NK cells in the decidua are very poor. A recent report describes the presence in decidual tissue of Lin
–
CD34
+
CD45
+
cells that express IL-
15/IL-2 receptor common β-chain (CD122), IL-7 receptor α-chain (CD127), mRNA for E4BP4 (E4 promoter binding protein 4), ID2 (inhibitor of DNA binding 2) transcription factor, CD117 and α7 integrin. In the presence of decidual stromal cell-derived conditioned medium supplemented with
IL-15 and stem cell factor, these hematopoietic progenitors undergo proliferation and differentiation into CD56
+
CD16
–
CD94
+
CD9
+
NK cells, thus acquiring a phenotype similar to that of uNK cells.
These results support the possibility that uNK cells derive from progenitors that constitutively reside in uterine tissue or are periodically repopulated by progenitor cells circulating in the blood
(Keskin, Allan et al. 2007; Vacca, Vitale et al. 2011). Recently it was demonstrated that the
secondary lymphoid tissues (SLT) hosts a complete pathway of NK cell development, starting with multipotential stage 1 (CD34+ CD117- CD94-) and 2 (CD34+ CD117+ CD94-) cells, going through NK-committed stage 3 cells (CD34- CD117+ CD94-) and finally becoming mature stage 4
(CD34- CD117-/+ CD94+) NK cells (Freud, Becknell et al. 2005; Freud and Caligiuri 2006). It has
emerged that SLT stage 3 is a heterogeneous population, both phenotypically and functionally, in which some cells are more capable of acquiring markers of mature NK cells, while others produce
IL-22 (Hughes, Becknell et al. 2009; Crellin, Trifari et al. 2010; Hughes, Becknell et al. 2010).
Male et al. recently have shown that CD117+ CD94- CD3- cells phenotypically similar to SLT stage 3 cells are present in human uterine mucosa. This population contains some cells that have
NK progenitor potential and some that are IL-22 producers, both functions are likely to be
important at this site (Male, Sharkey et al. 2011).
A number of studies, aimed at understanding the mechanisms underlying accumulation of uNK cells during first trimester pregnancy or menstrual cycle, suggest that NK cells recruitment from
blood can contribute to this process (Chantakru, Miller et al. 2002; Carlino, Stabile et al. 2008).
36

Migration of NK cell from blood to the tissues, as for other lymphocytes, is a spatially and temporally integrated multi-step process regulated by a number of chemoattractants and adhesive
molecules belonging to the selectin, integrin, and immunoglobulin families (Timonen 1997). Both
selectins and integrins contribute to the initial leukocyte tethering and rolling along the endothelial vessel, while firm adhesion of the leukocyte to vascular endothelium and subsequent diapedesis into
the underlying extravascular tissue is mainly mediate by integrins (Springer 1994; Kunkel and
Butcher 2002). The various steps of migration are tightly regulated and, for migration to be
effective, adhesion receptors must undergo cycles of attachment and detachment from their endothelial ligands. Consequently, a specific expression of adhesion molecules, as well as their ligands, may contribute to NK cell accumulation in the uterine compartment. In regard to the adhesion molecules, evidences indicate that L-selectin expression on CD56 high
pbNK cells from women in the reproductive age does not vary during the menstrual cycle, while the expression levels of the L-selectin ligand CSPG-2 (chondroitin sulfate proteoglycan-2) on the endothelial cells of endometrium, are higher in the secretory than in the proliferative phase of the menstrual cycle.
Thus, a crucial role for L-selectin-CSPG-2 interaction in the control of tethering and rolling of peripheral blood CD56 high
NK cells on endometrial endothelial cells has been suggested
(Yamaguchi, Kitaya et al. 2006).
NK cells also express other selectin ligands, namely the sialy stage-specific embryonic antigen 1, sialyl-Lewis x (sLe x ) ligand and the PSGL-1 (P-selectin glycoprotein ligand-1) that bind to E- and P-
selectin under static and flow conditions (Moore and Thompson 1992; Pinola, Saksela et al. 1994;
Snapp, Ding et al. 1998; Yago, Tsukuda et al. 1998), and decidua basalis endothelial cells express
both E- and P-selectins (Burrows, King et al. 1994).
In regard to the expression of VCAM-1 in the uterine compartment, endometrial endothelial cells fail to express it in the proliferative phase, but they acquire VCAM-1 between the mid and late
37

secretory phase, thus suggesting that α4β1-VCAM-1 adhesive pathway plays a role in NK cell
adhesion to endometrial endothelial cells after ovulation (Rees, Heryet et al. 1993).
Interestingly, studies in the mouse model have demonstrated that MAdCAM-1 and P-selectin are co-expressed in the uterus on the vessels of vascular zone while VCAM-1 is mainly present in the vessels of decidua basalis. The unusual co-expression of P-selectin and MAdCAM-1 at this site has been suggested to provide a mechanism for selecting specialized subsets of leukocytes displaying a
combination of P-selectin and MAdCAM-1 binding activities (Fernekorn, Butcher et al. 2004).
In addition, Fernekorn and co-workers also showed that at day 11 of pregnancy, implantation sites of mice lacking P-selectin or β7 integrin or treated with blocking antibodies against MAdCAM-1 or
α4β7 integrin, lack α6β7 +
leukocytes and are characterized by altered size and frequency of uNK cells.
In regard to the expression of the β2 integrin ligands on the endothelial cells of uterine compartment, there are evidences indicating that ICAM-1 is constitutively and constantly expressed throughout the menstrual cycle and by all vascular endothelium throughout the decidua, while
ICAM-2 is only marginally expressed (Tawia, Beaton et al. 1993; Burrows, King et al. 1994).
It can be postulated that differential expression of adhesion molecules on endometrium together with quantitative and qualitative regulation of integrin expression and function occurring following
NK cell activation, are responsible for the recruitment of specialized NK cell subsets during pregnancy. Interestingly, exposure of peripheral blood leukocytes to pregnancy-associated hormones results in enhanced adhesiveness of peripheral blood NK cells to decidual vascular
endothelial cells through L-selectin- and α4 integrin-dependent mechanisms (Chantakru, Wang et
al. 2003; van den Heuvel, Horrocks et al. 2005). Thus, it is likely that pregnancy associated factors
acting at systemic level such as sex hormones or cytokines can enhance the adhesive and migratory capacity of peripheral blood NK cells.
38

In regard to the chemotactic factors potentially involved in the control of NK cell accumulation in the uterus, it has been shown that endometrial cells express many chemokines belonging to the CC,
CXC and CX3C families that can exert their activity on peripheral blood NK cells.
Immunohistochemical analysis has revealed that endometrial endothelial, epithelia, and stromal cells express CCL4/MIP-1β, CCL5/RANTES, CCL7/MCP-3, CCL19/ELC, CCL21/SLC,
CXCL9/Mig and CXCL10/IP-10, among the CC and CXC chemokine families, and that their expression levels vary depending on the phase of menstrual cycle, being higher in the secretory
phase than in the proliferative phase (Hornung, Ryan et al. 1997; Kitaya, Nakayama et al. 2003;
Kitaya, Nakayama et al. 2004). Among chemokines present in decidual tissues,
CX3CL1/Fractalkine, known as one of the major chemoattractant for NK cells and other cytotoxic lymphocytes, is the most abundant. Immunohistochemical studies have demonstrated that
CX3CL1/Fractalkine is mainly present in glandular epithelial cells, decidualized stromal cells and in endothelial cells, and, as for the above mentioned chemokines, its expression is maximal during
the secretory phase of the menstrual cycle and early pregnancy (Hannan, Jones et al. 2004).
Furthermore, several reports underlain the capacity of also first-trimester human trophoblast to express chemokines able to act on NK cells, namely CXCL12/SDF-1 and CCL3/MIP-1α. In addition, primary cultures of trophoblast cells can spontaneously secrete CXCL12/SDF-1 and
CCL3/MIP1α but not the ligands for CXCR3, CXCL9/Mig, CXCL10/IP-10 and CXCL11/I-TAC
(Drake, Gunn et al. 2001; Hanna, Wald et al. 2003; Wu, Jin et al. 2005).
The cyclical variations in chemokine expression levels found in the endometrium during
endometrial breakdown, repair or embryo implantation (Jones, Hannan et al. 2004), strongly
suggest that sex hormones can regulate chemokine expression in the uterus. In this regard, in vitro treatment of stromal cells with progesterone but not 17 β-estradiol was found to enhance the production of CCL4/MIP-1β, CCL5/RANTES, CCL7/MCP-3, CXCL9/Mig and CXCL10/IP-10 but
not that of CCL19/ELC and CCL21/SLC (Kitaya, Nakayama et al. 2003; Kitaya, Nakayama et al.
39

2004). Moreover, by using an
in vitro organ culture system, Sentman and co-workers have demonstrated that both estradiol and progesterone can induce the expression of CXCL10/IP-10 and
CXCL11/I-TAC chemokines on human endometrium, but do not affect that of CCL3/MIP-1α,
CCL4/MIP-1β, CCL5/RANTES, or CCL21/SLC, thus suggesting that these hormones specifically
modulate chemokine expression in non-pregnant human endometrium (Sentman, Meadows et al.
2004).
In line with the observation that chemokine expression on endometrial tissues is maximal during the secretory phase and early pregnancy, several evidence have suggested that they can control recruitment and/or retention of NK cells in the decidua. In particular, it has been reported that chemokines produced by trophoblast or endometrial cells, such as CXCL9/Mig, CXCL10/IP-10 and
CXCL12/SDF-1, or CCL4/MIP-1β and CCL3/MIP-1α can support peripheral blood NK cell
chemotactic response (Drake, Gunn et al. 2001; Hanna, Wald et al. 2003; Kitaya, Nakayama et al.
2003). Furthermore, it was recently reported that CXCL12/SDF-1, CXCL10/IP-10 or
CX3CL1/Fractalkine can support pbNK cell migration through primary cultures of both DEC and
ST cells (Carlino, Stabile et al. 2008).
It was also shown that pbNK cells from first trimester pregnant women display higher migratory capacity as compared to pbNK cells of non-pregnant women or male donors even if they express comparable levels of chemokine receptors or integrin subunits, thus suggesting that pregnancy associated factors acting at systemical level including hormones such as prolactin, chorionic gonadotrophin, oestrogens and/or inflammatory cytokines such as IL-12 and IL-18, can modulate the migratory behavior of pbNK cells without affecting their integrin and chemokine receptor
profile (Carlino, Stabile et al. 2008).
Studies aimed at understanding whether chemokines secreted locally by decidual cells can preferentially attract a subset of pbNK cells, have shown an enhanced responsiveness of CD56 high
NK cells to CCL3/MIP-1α and CXCL12/SDF-1 released in the supernatants of cultured trophoblast
40

cells (Drake, Gunn et al. 2001; Wu, Jin et al. 2005). However, evidence so far available in the
mouse models have not allow to identify a particular chemokine receptor-ligand system involved in the control of uterine NK cell accumulation. Indeed, no changes in NK cell localization and activation have been observed in mice genetically-ablated for CCR2, CCR5, and CCL3/MIP-1α or
mice doubly deleted for CCL3/MIP-1β and CCR5 (Chantakru, Kuziel et al. 2001). This may be
attributable to the known redundancy of the chemokine system, as well as to differences in the human versus mouse pregnancy.
Regardless of their origin, it is likely that dNK cells are influenced by specific factors present in their local environment. Accumulating evidences indicate that signals provided by decidualized ST cells, including IL-15 and IL-11, critically control uNK development and/or functional
differentiation (Verma, Hiby et al. 2000; Zourbas, Dubanchet et al. 2001; Ain, Trinh et al. 2004). In
this regard, it has been shown that incubation of CD16
-
pbNK cells with IL-15 results in the
induction of a chemokine receptor pattern similar to that of uNK cells (Hanna, Wald et al. 2003).
Furthermore, it was demonstrated that human pbNK cells acquire a chemokine receptor repertoire
similar to that of decidual NK cells when they contact decidual ST cells (Carlino, Stabile et al.
2008). Moreover, recent evidences indicate that culture of CD16
+
pbNK cells with conditioned medium derived from decidual ST cells results in conversion of CD16
+
pbNK cells into CD16
-
cells as well as in the up-regulation of CD9 expression, and these effects are clearly dependent on TGF
 released by ST cells, suggesting an important role for TGF

in influencing the uNK cell phenotype
(Keskin, Allan et al. 2007).
41

Aim of this work was to evaluate whether chemerin could play a role in the control of crucial events relevant for the good outcome of pregnancy, such as pbNK cell recruitment and vascular remodelling during first trimester of gestation.
In order to investigate this hypothesis, we first analyzed chemerin mRNA expression in different cell populations of the decidual microenvironment. We also evaluated whether the expression and release of this chemotactic factor was correlated to different phases of woman reproductive life by comparing uterine ST cells obtained from fertile non-pregnant, pregnant and menopause women, and whether pregnancy-associated hormones could play a role in chemerin modulation.
Then we tested the ability of chemerin to support the migration of pbNK cells, isolated from women in the first trimester of gestation, through DECs and ST cells. Once in the uterus, NK cells should migrate through decidual tissues in order to localize in specific areas, thus we decided to analyze whether chemerin is also able to support dNK cell migration through ST cells.
Since it is likely that dNK cell behaviour is influenced by stimuli present in the uterine environment, we investigated whether chemerin receptor profile of pbNK cells isolated from pregnant women might undergo tissue-specific modulation once these cells contact DEC or ST cells.
Furthermore, it was recently demonstrated that chemerin is able to induce capillary-tube formation of endothelial cells. Thus, we tested the ability of this chemotactic factor to induce vascular morphogenesis of DECs in order to contribute to the formation of new vessels during early phases of pregnancy.
42

Cells
Human pbNK and dNK cell purification: mononuclear cells were isolated from pb of women undergoing elective pregnancy termination (8-12 weeks of gestation), by Lymphoprep (Nycomed
AS, Oslo, Norway) gradient centrifugation. Cells were then incubated with FITC-conjugated anti-
CD3 plus anti-CD14 and PE-conjugated anti-CD19 mAbs (BD Biosciences, San José, CA) for 30 min at 4°C, and NK cells were negatively selected by a FACSAria cell sorter (BD Biosciences); for some experiments, NK cells were purified by negative immunomagnetic selection using the
Miltenyi NK cell isolation kit (Miltenyi Biotec GmbH, Germany). The purity of the NK cell populations obtained was routinely more than 95% CD56 + CD16 + CD3 CD9 CD14 as assessed by immunofluorescence and cytofluorimetric analysis using FACSCalibur (BD Biosciences).
Decidual samples from elective first-trimester pregnancy terminations were washed extensively in
PBS, minced with a sterile scissor, and digested with 1.5mg type I DNase and 24mg type IV collagenase (Sigma-Aldrich, St Louis, MO) in 5ml RPMI medium for 30 min at 37°C. Cells were then purified by Lymphoprep density gradient centrifugation and immediately used for three color immunofluorescence and cytofluorimetric analysis. For migration assay, dNK cells were further purified through positive selection by cell sorting and for western blotting assay by immunomagnetic negative selection using the Miltenyi NK cell isolation kit. The purity of the resulting dNK cell populations was more than 90% CD56
+
CD9
+
CD16
-
CD3
-
CD14
-
.
Decidual human endothelial (DEC), stromal (ST), and trophoblast cell (EVT) purification: endothelial and stromal cells from decidual tissues of women undergoing elective pregnancy termination or stromal cells from endometrial tissues of menopause or fertile women undergoing hysterectomy for leiomyomatosis in the mid proliferative and secretory phase, accordingly to
Noyes criteria, were purified as previously described with some modifications (Noyes, Hertig et al.
43

1975; Bulla, Villa et al. 2005; Spessotto, Bulla et al. 2006). Briefly, tissues were digested overnight
at 4°C with 0.25% trypsin (Sigma-Aldrich), 50µg/ml DNase1 (Boehringer Mannheim, Germany) in PBS and then treated with collagenase type I (3mg/ml) (Worthington Biochemical Corporation,
DBA, Milano, Italy) for 30 min at 37°C. Following Lymphoprep density gradient centrifugation,
DEC were isolated by positive selection using Dynabeads M-450 (Dynal, Oslo, Norway) coated with lectin ulex europaeus 1 (Sigma-Aldrich). The purity of the resulting DEC population was more than 98% as verified by staining with antibodies to von Willenbrand factor (vWF), CD105,
VE cadherin (Dako, Milano, Italy) and CD31/PECAM-1 kindly provided by M. R. Zocchi (San
Raffaele Hospital, Milan, Italy) (data not shown). DEC were cultured using endothelial serum free medium (SFM) (GIBCO, Carlsbad, CA) supplemented with 10% human serum, 20 ng/ml bFGF,
10 ng/ml EGF and penicillin (50 U/ml)/streptomycin (50 μg/ml).
Decidual or endometrial ST cells were obtained by culturing the endothelial negative cell fraction in RPMI plus 10% fetal calf serum (FCS) without adding cytokines. Nonadherent cells were removed by extensive washing, and adherent cells were used only when they were negative for
CD14, CD45 (BD Biosciences), cytokeratin 8-18, vWF or CD31 and positive for a-actin, vimentin,
CD13, CD10 and CD105 (Dako) (data not shown). For the experiments, DEC and ST cell primary cultures between the third and sixth passage were used.
EVT were purified from placental specimens after removal of decidual tissue and fetal membrane
as previously described (Bulla, Villa et al. 2005). Briefly, placental tissue was incubated with
HBSS containing 0.25% trypsin and 0.2mg/ml DNase (Roche, Milan, Italy) for 20 min at 37°C.
After Percoll gradient fractionation, leukocytes were immunomagnetically depleted using anti-
CD45 precoated beads (Dynal, Invitrogen, Milan, Italy). EVT collected by negative selection were seeded in 5µg/cm 2
FN (Roche)-precoated flask, cultured overnight in RPMI (GIBCO) supplemented with 10% FCS and detached by trypsin-EDTA treatment. The cells obtained were
95% cytokeratin 7-positive EVT and few vimentin-positive decidual ST cells (data not shown).
44

The presence of contaminating leukocytes and DEC was excluded by RT-PCR assay for CD45 and
FACS analysis with anti-vWF and anti-CD31 antibodies respectively.
Informed consent was obtained from all donors providing peripheral blood and tissue specimens, and ethical approval was obtained from the Ethics Committee of University “La Sapienza” Rome,
Rome, Italy, and the Ethics Committee of the Maternal-Children Hospital (Istituto di Ricovero e
Cura a Carattere Scientifico

IRCCS

“Burlo Garofolo”, Trieste, Italy).
Real time quantitative PCR analysis
Chemerin and β-actin mRNA expression was analyzed by real time quantitative PCR using a commercial Taqman assay reagent. PCR reactions were performed on ABI Prism 7700 Sequence
Detection System according to the manufacturer’s instructions. cDNA was amplified in triplicate with primers for chemerin (Hs00161209_g1) conjugated with fluorochrome FAM, and β-actin
(4326315E) conjugated with fluorochrome VIC (Applied Biosystems, Foster City, CA). For each amplification run, a standard curve was generated using five serial dilutions of total cDNA derived from decidual ST cells. Each cDNA tested was diluted 5-fold and 2.5ml of the diluted cDNA was added to 22.5ml of the reaction mixture for PCR amplification. The average of the threshold cycles were used to interpolate standard curves and to calculate the transcript amount in samples using
SDS version 1.7a software. The relative chemerin amount of each sample, normalized with β-actin, was expressed as arbitrary units.
The primer pairs used for RT-PCR analysis were: chemerin, forward
CAGGAATTCAGCATGCGACGGCTGCTGA and reverse GCTCTA
GATTAGCTGCGGGGCAGGGCCTT (CLONTECH Laboratories, Inc., San Jose, C); β-actin, forward GGGTCAGAAGGATTCCTATG and reverse GGTCTCAAACATGATCTGGG (Applied
Biosystems, Foster City, CA).
45

ELISA
ST cells (1.5x10
5 cells/well/300µl) from fertile non-pregnant, pregnant and menopause women cultured with medium alone or supplemented with 100 nM progesterone and 1nM oestrogen were incubated for 24 hours at 37°C. After incubation culture supernatants were harvested and 100  l of sample were assayed for the presence of chemerin using the human chemerin DuoSet ELISA from
R&D (R&D System, Minneapolis, MN) according to the manufacturer’s instructions. Each sample was analyzed in duplicate. Optical density was determined using a microplate ELISA reader
(Labsystems Multiskan MS, DASIT). Sample data were obtained by interpolating the mean of optical density of each sample into a standard curve generated from a 2-fold serial diluition of recombinant human chemerin. Data are expressed as ng of chemerin released by 1x10 6 cells.
Immunoprecipitation and western blotting analysis
To assay the expression of chemerin on ST decidual cells, ST cell primary cultures (3x10
6
cells) and freshly isolated decidual cells (40x10
6
cells) were lysed for 30 min at 4°C in ice-cold lysis buffer (1% (v/v) Triton-X100, 1mM CaCl
2
, 1mM MgCl
2
, 0.1% NaN
3
, 1mM PMSF, 2μg/ml aprotinin, 2μg/ml leupeptin, 10mM NaF, 150mM NaCl, 10mM iodoacetamide, 1mM Na
3
VO
4
, in
50mM Tris, pH 7.5). Cell lysates were immunoprecipitated with an anti-human chemerin goat Ab
(R&D System). The resulting immunocomplexes and total cell lysates from 5x10
5
ST cells and
3x10
6
decidual cells were resolved by 15% SDS-PAGE, transferred to nitrocellulose and immunoblotted with anti-chemerin goat Ab.
To evaluate Erk activation on dNK cells upon chemerin receptor engagement, dNK cells (4x10
5 cells) were stimulated with chemerin (10 nM) or CXCL12/SDF-1 (250 nM) (R&D System) or with anti-ChemR23 (clone 4C7) or with anti-CD56 (clone C218) mAbs preadsorbed to 96 well plate for the indicated time periods at 37°C. Stimulation was stopped by adding ice-cold lysis buffer and cell lysates were resolved by 12.5% SDS-PAGE, transferred to nitrocellulose and sequentially
46

immunoblotted with anti-pErk mAb (Cell Signalling Technology, Inc., Danvers,MA) and anti-Erk rabbit Ab (Santa Cruz Biothecnology, Inc., CA).
To evaluate Erk activation on DEC, 2x10
5
cells were starved in human endothelial SFM for 18h at
37°C and then stimulated with different concentrations of chemerin or with anti-ChemR23 crosslinked with goat anti-mouse secondary Ab (GAM) (Cappel Laboratories, Cooper Biomedical
Inc., Malvern, PA). Cells were then lysed and Erk phosphorylation was assayed as above.
Immunofluorescence and flow cytometric analysis
Chemerin receptor expression on freshly isolated pbNK cells or dNK cells was evaluated by performing a three color immunofluorescence staining. Cells were washed with PBS and incubated with anti-ChemR23 (clone 1H2 or clone 4C7) or affinity purified normal mouse IgG (SIGMA) for
30 min on ice followed by fluorochrome-conjugated F(ab’)2 fragments of GAM (Cappel
Laboratories, Cooper Biomedical Inc., Malvern, PA); cells were then incubated for 15 min with normal mouse serum, and for additional 30 min at 4°C with anti-CD3 and anti-CD56 fluorochrome-conjugated mAbs. For fluorescence measurement only data from 10000 to 30000 single cell events were collected using a standard FACScalibur flow cytometer and gated
CD56
+
CD3
-
NK cells were analyzed using CELLQuest (BD Biosciences). PBMC type IV collagenase treatment did not affect ChemR23 expression on pbNK cells (data not shown).
Migration assay
Cell migration was measured using a Transwell migration chamber (diameter insert 6.5 mm, pore size 5 μm; Costar Corporation, Cambridge, MA).
Highly purified NK cells derived from peripheral blood of women in the first trimester of pregnancy, or from decidual tissue were assayed for their ability to migrate through a monolayer of DEC, or ST cells grown or not with progesterone (100 nM). As chemoattractant, different concentrations of chemerin (R&D System) were added in the
47

lower compartment. After 120 min at 37°C, the number of migrated cells was evaluated using the
FACScalibur cytofluorimeter (BD Biosciences). Data are expressed as the mean + SD of % of migrated cells obtained from four independent experiments.
DEC capillary-like tube formation assay
To perform this assay, DEC were starved in Human Endothelial SFM (GIBCO) plus 0.5% FCS for
12 h at 37°C and then seeded onto Matrigel (BD Biosciences, San José, CA) pre-coated wells at a density of 40x10
3
cells/well in the absence or in the presence of different concentrations of chemerin (10-30 nM). Following 8 h incubation at 37°C, the formation of capillary-like tube was assessed and photographed at 10X magnification with a LEICA (Wetzlar, Germany) microscope equipped with digital camera (LEICA, DFC420C).
Co-culture of pbNK cells with stromal or endothelial decidual cells pbNK cells from women in the first trimester of pregnancy were co-cultured in 24-well plates precoated with DEC or ST cells grown in the presence of progesterone or medium (RPMI plus 10%
FCS). Following 36 hours of incubation at 37°C, NK cells were recovered and analyzed for the chemerin receptor expression by three color immunofluorescence staining and FACS analysis as above described.
Statistical analysis: Student’s t test was used for statistical evaluations.
48

Chemerin mRNA expression on decidual ST, DEC, and EVT cells
Many works have supported the idea of an NK cell recruitment from peripheral blood in order to explain the dramatic accumulation of NK cells in the maternal uterus during the first trimester of pregnancy. However, the molecular events involved in this process are still poorly defined.
NK cell recruitment and localization into tissues is mainly orchestrated by specific chemokines and chemotactic factors. We have focused our attention on a novel chemoattractant, chemerin, that has been recently shown to support NK cell chemotaxis in vitro
(Parolini, Santoro et al. 2007).
Originally chemerin was isolated from inflamed biologic fluids, in particular nanomolar concentrations of bioactive chemerin were found in the ascites secondary to ovarian carcinomas.
Thus, we wondered whether chemerin could be expressed also in the decidual microenvironment.
To this aim, we performed Real Time PCR analysis on total RNA obtained by primary cultures of
DECs, decidual ST cells and extravillous trophoblast (EVT) isolated from first trimester decidual tissues. As shown in figure 10, we found that chemerin is differentially expressed by the decidual cell components analyzed, indeed this chemoattractant is expressed at high levels by both ST cells and EVT, while undetectable levels of chemerin mRNA were found on DECs.
Figure 10. Chemerin mRNA expression on DECs, EVT and decidual ST cells
A: mRNA isolated from DEC, ST cell, or EVT primary cultures obtained from the same donor were analyzed by real time quantitative PCR assay for the expression of chemerin. The relative chemerin amount
49

of each sample was normalized with

-actin and expressed as arbitrary units + SD. Results obtained from three different donors are shown.
B: mRNA isolated from two different decidual ST cell, three different DEC and two different EVT primary cultures were analyzed by RT-PCR for the expression of chemerin. β-actin is shown as mRNA loading control. These results are representative of three independent experiments.
In agreement with this observation, we also found that EVT and ST cells, but not DECs, were able to secrete substantial levels of chemerin in their culture supernatants (data not shown).
Chemerin expression and secretion by ST cell primary cultures derived from fertile, pregnant and menopause women
In order to evaluate whether the early pregnant status could affect chemerin mRNA expression on
ST cells, we have analyzed by Real Time PCR the mRNA expression levels on uterine ST cells isolated from women in different phases of their reproductive life: fertile non-pregnant women, pregnant women, and women in menopause.
As shown in figure 11, we found that the three ST populations analyzed express different levels of chemerin and, interestingly, the higher expression level was found on ST cells isolated from pregnant women. These results suggest that pregnancy-associated factors can modulate chemerin expression on ST cells.
Figure 11. Chemerin mRNA expression in fertile, pregnant and menopause uterine ST cells
50

mRNA isolated from primary cultures of ST cells obtained from fertile non-pregnant, pregnant and menopause women were analyzed for the expression of chemerin by real time quantitative PCR assay. The mean ± SD of chemerin mRNA expression obtained from different donors (n) are shown.
*P<0.02 and **P<0.01 as evaluated by performing Student’s t test statistical analysis between ST cells from pregnant versus fertile and menopause women respectively.
Based on the evidence indicating a crucial role for sex hormones in the regulation of decidualization process, we also evaluated the ability of uterine ST cell primary cultures isolated from fertile, pregnant and menopause women to secrete chemerin and the effect exerted by progesterone and oestrogen on this event.
As shown in figure 12, ST cells from pregnant women were able to release higher amount of chemerin with respect to uterine ST cells from fertile or menopause women. Western blotting analysis of ST cells from first trimester pregnant women reveals that they were able to produce a form of chemerin that migrates with an apparent molecular weight similar to that of the human recombinant chemerin (Fig. 12, inserted panel).
Figure 12. Chemerin expression and secretion by uterine ST cells
Culture supernatants of ST cells (150x10 3 cells/well/ 300 ml) from fertile non-pregnant, pregnant and menopause women grown with medium alone or supplemented with progesterone (100nM) and oestrogen
(1nM) were harvested after 24 hours of incubation at 37°C and then tested for the presence of chemerin by
ELISA. Each circle represents one donor and the number (n) of the donors tested for each group is shown.
Black lines indicate the mean value of each group. *P < 0.03, as evaluated by comparing progesterone and oestrogen-treated versus untreated ST cells using Student’s t test statistical analysis.
Inserted panel: Primary cultures of ST cells (3x10 6 cells) and freshly isolated decidual cells (40x10 6 cells) were lysed and immunoprecipitated with goat anti-human chemerin Ab. The resulting immunocomplexes
51

and total cell lysates (5x10 3 ST cells, 3x10 6 decidual cells) were resolved by 15% SDS-PAGE, transferred to nitrocellulose and immunoblotted with anti-chemerin goat Ab. 50ng of recombinant human chemerin were loaded as positive control. These results represent one of three independent experiments.
Moreover, exposure of uterine ST cells from fertile, pregnant, and menopause women to progesterone and oestrogen resulted in up-regulation of chemerin release.
These results indicate that pregnancy-associated hormones can positively modulate the ability of
ST cells to express and release this chemotactic factor in decidua microenvironment.
Chemerin receptor expression on pbNK and dNK cells
Chemerin has been identified as the natural ligand for ChemR23, a G  i
-linked receptor that exhibits a specific expression profile among leukocyte populations being expressed preferentially by monocytes/macrophages and by immature myeloid and plasmacytoid dentritic cells. Recently it has been reported that ChemR23 is expressed also by the cytotoxic subset of NK cells in the peripheral
blood (Parolini, Santoro et al. 2007). To evaluate whether chemerin can contribute to the
recruitment of pbNK cells in the decidua and to the correct positioning of dNK cells into the uterus during early pregnancy, pbNK cells and dNK cells were initially analyzed for the expression of
ChemR23. To this aim pb and decidual leukocytes were isolated from the same first trimester pregnant woman and gated CD56
+
CD3
-
NK cells were assayed for the expression of ChemR23 by three color immunofluorescence and flow cytrometric analysis.
As shown in figure 13, dNK cells were mainly CD56 high
CD16
-
, and the majority expressed the tetraspannin CD9, while both pbNK cell subsets, CD56 high CD16 and CD56 low CD16 high , differently from the dNK cell counterpart, showed undetacteble levels of CD9.
52

Figure 13. Human pb and dNK cell phenotypic characterization
Mononuclear cells were isolated from peripheral blood of women undergoing elective pregnancy termination
(8-12 weeks of gestation) by Lymphoprep gradient centrifugation, and then was assayed by three color immunofluorescence using PE-conjugated anti-CD56, PerCP-conjugated anti-CD3, FITC-conjugated anti-
CD16 or anti-CD9 mAbs and analyzed by flow cytometry. Decidual samples from elective first-trimester pregnancy terminations were digested with type IV collagenase and then, the cell suspensions were purified by Lymphoprep density gradient centrifugation and immediately used for three color immunofluorescence and cytofluorimetric analysis. dNK cells are mainly CD56 + CD16 CD9 + while pbNK cells were mainly
CD56 + CD16 + CD9 .
In agreement with previous observations (Parolini, Santoro et al. 2007), we found that CD56
low
CD16 high pbNK cells are positive for the expression of ChemR23, while the CD56 high CD16 low/pbNK cell subset does not express this receptor. No differences were observed in the expression levels of ChemR23 on pbNK cells isolated from pregnant versus non-pregnant women (data not shown). By contrast, as shown in figure 14, differently from their peripheral blood counterpart, dNK cells express only modest levels of ChemR23.
These results demonstrate that ChemR23 is differentially expressed on circulating versus uterusresident NK cells during pregnancy, thus suggesting that, as previously observed for several
chemokine receptors (Carlino, Stabile et al. 2008), pregnancy associated factors can also affect the
ChemR23 expression on dNK cells.
53

Figure 14. Chemerin receptor expression on pbNK and dNK cells of women in the first trimester of pregnancy
Freshly isolated pb and dNK cells from the same woman in the first trimester of pregnancy were evaluated for the expression of the chemerin receptor, ChemR23, by three color immunofluorescence and cytofluorimetric analysis using a mouse mAb anti-ChemR23. The dot plots shown indicate the expression of
ChemR23 on gated CD56 + CD3 NK cells. Staining with normal mouse IgG followed by FITC-conjugated
GAM Abs was used as control. The percentage of positive cells and the mean fluorescence intensity (m) were shown. Data are representative of four independent experiments.
Chemerin supports pbNK cell and dNK cell migration through DECs and ST cells
In order to accumulate in the parenchimas of organs, such as uterus, initially pbNK cells must leave the circulation by means of a transendothelial migration. To evaluate whether chemerin can affect the ability of pbNK cells to migrate through DEC or ST cells, freshly isolated highly purified pbNK cells, obtained from first trimester pregnant women undergoing elective pregnancy termination, were allowed to migrate through either DEC or ST cells using different concentrations of chemerin as chemoattractant.
54

As shown in figure 15 (panels A and B), we observed that chemerin significantly supports pbNK cell migration through both DECs and ST cells. As we found that treatment with progesterone and oestrogen up-regulates chemerin expression and secretion by ST cells, and since it has been reported that NK cells exhibit an enhanced adhesion and migration through pregnant tissues, we assayed the ability of pbNK cells from pregnant women to migrate in response to chemerin through decidual ST cells cultured with progesterone. The results obtained indicate that progesterone treatment of ST cells did not significantly affect the migratory behaviour of pbNK cells isolated from first trimester pregnant women in response to chemerin (Fig.15, panel B).
Figure 15. Migration of pbNK and dNK cells from pregnant women through DECs and ST cells
Highly purified pbNK cells isolated from first trimester pregnant women were assayed for their ability to migrate through a monolayer of primary cultures of DEC (panel A) or decidual ST cell grown with or
55

without progesterone (100 nM) (panel B) using different concentrations of chemerin as chemoattractant.
Panel C: Highly purified pbNK cells or dNK cells from the same women in the first trimester of pregnancy were assayed for their ability to migrate through a monolayer of primary cultures of ST decidual cells grown in the presence of progesterone (100 nM) as above.
All data are expressed as the mean ± SD of the percentage of migrated cells obtained from two independent determinations.
These data first demonstrate that chemerin can support pregnant pbNK cells migration through both endothelial and stromal decidual tissues, and they also suggest that fluctuations of progesterone and oestrogen levels occurring during early pregnancy can tightly control this process by acting on ST cells and modulating the production of this chemoattractant.
To investigate the ability of chemerin to support also dNK cell migration through ST cells, freshly isolated highly purified dNK and pbNK cells, derived from the same donor (Fig. 16), were allowed to migrate through ST cells.
A
B
Figure 16. Human pb and dNK cell purification
Panel A: Mononuclear cells were isolated from peripheral blood and deciduas of women undergoing elective pregnancy termination and then NK cells were purified as described in the legend of Fig. 13.
Panel A: mononuclear cells were then incubated with anti-CD3 plus anti-CD14 and anti-CD19 mAbs for 30 min at 4°C, and NK cells were negatively selected by immunomagnetic depletion. The resulting NK cell
56

population was assayed by three color immunofluorescence using PE-conjugated anti-CD56, PerCPconjugated anti-CD3, FITC-conjugated anti-CD16 or anti-CD9 or anti-CD14 mAbs and analyzed by flow cytometry using a FACSCalibur. The purity of the resulting pbNK cell population was more than 97%
CD56 + CD3 . These cells were also shown to be CD16 + CD9 CD14 - (data not shown).
Panel B: dNK cells were immediately purified through staining with PE-conjugated anti-CD56 and PerCPconjugated anti-CD3 and positive selection by cell sorting. The purity of the resulting dNK cell population was more than 95% CD56 + CD3 . These cells were also shown to be CD9 + and CD16 - (data not shown).
As shown in figure 15 (panel C), chemerin was able to significantly support dNK cell migration through ST cells even if the degree of dNK cell migration was lower than that observed for the peripheral blood counterpart.
These data strongly correlate with the ChemR23 expression levels observed on dNK versus pbNK cells, and suggest that dNK cells are endowed with a functional chemerin receptor.
ChemR23 expression on human pbNK cells is modulated upon co-culture with ST decidual cells
The differences found between the chemerin receptor profile of pbNK cells versus dNK cells prompted us to hypothesize that the chemerin receptor repertoire of human pbNK cells undergoes tissue specific modulation when these cells are recruited to the uterus as we previously reported for
other chemokine receptors (Carlino, Stabile et al. 2008). In order to verify this hypothesis, pbNK
cells isolated from first trimester pregnant women were co-cultured with DECs and decidual ST cells for 36 hours (Fig. 17), and then assayed for the expression of ChemR23 by three color immunofluorescence and cytofluorimetric analysis.
57

Figure 17. pbNK cells co-culture with decidual cells pbNK cells from women in the first trimester of pregnancy were co-cultured in 24-well plates precoated with primary culture of DEC or ST cells grown in the presence of progesterone or medium (RPMI plus 10%
FCS). Following 36 hours of incubation at 37°C, NK cells were recovered and analyzed for the ChemR23 expression by three color immunofluorescence staining and FACS analysis.
As shown in figure 18, following co-culture with ST cells, pbNK cells showed a significant down-regulation of ChemR23, thus acquiring a chemerin receptor profile closely resembling that of dNK cells. A certain degree of modulation of ChemR23 expression was observed also when NK cells were cultured with control medium alone, but the variations observed were much lower. Moreover, when pbNK cells were co-cultured with DECs the modulation of the
ChemR23 expression profile on pbNK cells was not observed.
58

Figure 18. Chemerin receptor expression on pbNK cells co-cultured with DECs and decidual ST cells pbNK cells from first trimester pregnant women were co-cultured with ST cells grown in the presence of progesterone (100 nM), DECs or with control medium for 36 hours at 37°C. After incubation, ChemR23 expression was analyzed on gated CD56 + CD3 NK cells. Control represent staining with FITC-conjugated
GAM Ab. (T
0
) Staining for the chemerin receptor expression on NK cells at the start of the experiment. Data are representative of four independent experiments.
These results indicated that the ChemR23 expression on human pbNK cells, as we previously
reported for other chemokine receptors (Carlino, Stabile et al. 2008), may undergo tissue specific
modulation when these cells are exposed to signals delivered by ST cells but not DECs into the uterus.
ChemR23 stimulation enhances pErk activation in dNK cells
To further support the ChemR23 functional ability on dNK cells, we analyzed its capacity to activate the MAP kinase Erk, a signaling molecule involved in the regulation of many cell functions including migration. Thus, highly purified dNK cells were stimulated for the indicated time with CXCL12/SDF-1 or chemerin or with cross-linked mAb directed against CXCR4, or
59

B).
ChemR23. Stimulations with CXCL12/SDF-1 or with anti-CXCR4 were used as positive controls while that with anti-CD56 mAb as negative control. As shown in figure 19, dNK cell stimulation with CXCL12/SDF-1 or chemerin resulted in Erk activation that was already evident at 1 min and still persisted at 7 min after stimulation (panel A). Erk activation was also observed after dNK cell stimulation for 3 min with cross-linked Ab against CXCR4 or ChemR23. By contrast, stimulation with anti-CD56 control mAb did not significantly affect the phosphorylation status of Erk (panel
A B
Figure 19. ChemR23 stimulation enhances pErk activation in human dNK cells
Human dNK cells were left untreated (-) or stimulated with chemerin (10nM) or with CXCL12/SDF-1 (250 nM) (panel A) or with Ab against ChemR23 or CD56 precoated to 96 well plate (panel B) for the indicated time periods at 37°C. After stimulation cells were lysed and total cell lysates were resolved by SDS-PAGE, transferred to nitrocellulose and sequentially immunoblotted with anti-pErk mAb and anti-Erk rabbit Ab for loading control. These results represent one of two indipendent experiments .
These results demonstrate that chemerin receptor engagement on dNK cells rapidly results in Erk activation and, together with their ability to support dNK cell migration through stromal cells, indicate that this receptor is functional.
60

DECs express ChemR23 and undergo capillary-like tube formation upon chemerin stimulation
Remodeling of blood vessels in early pregnancy is a crucial event for the maintenance and the successful outcome of pregnancy and is a complex process regulated by many endothelial cell mitogenic signals and angiogenic factors. The recent observations that chemerin can modulate
human umbilical vein endothelial cell (HUVEC) angiogenesis (Bozaoglu, Curran et al. 2010; Kaur,
Adya et al. 2010) prompted us to evaluate whether this chemoattractant can exert a similar effect in
the uterine compartment. To this purpose, we first analyzed the expression of ChemR23 on DEC primary cultures and we found that DECs are positive for ChemR23 (Fig.20, panel A).
Figure 20. DEC express ChemR23 chemerin receptor and undergo pErk activation and capillary-like tube formation upon chemerin stimulation
Panel A: DEC were analyzed for the expression of ChemR23 by immunofluorescence and cytofluorimetric analysis.
Panel B: DEC were starved in human endothelial SFM for 18h at 37°C and then left untreated (-) or stimulated with different concentrations of chemerin or with anti-ChemR23 mAb for the indicated time periods at 37°C. After stimulation cell lysates were assayed for pErk activation as above described.
Panel C: DEC were starved in human endothelial SFM plus 0.5% FCS for 12h at 37°C and then seeded onto matrigel pre-coated wells at a density of 40x10 3 cells/well in medium alone or in the presence of different concentrations of chemerin (10-30 nM). Following 8h incubation at 37°C, the formation of capillary-like tubes was assessed and photographed at 10X magnification with a LEICA microscope equipped with a digital camera.
61

ChemR23 engagement on DECs with chemerin or specific Ab resulted in Erk activation that was already evident at 3 min after stimulation (Fig.20, panel B). Accordingly, when DECs were exposed to different concentrations of chemerin, their ability to form capillary-like tubes on
Matrigel was clearly enhanced in a dose dependent manner (Fig.20, panel C).
These results strongly suggest that chemerin could partecipate to the vascular remodeling that occurs inside the uterus in early pregnancy.
62

In this study we investigated the expression and regulation of the chemerin/chemerin receptor axis at the transcriptional and proteic level in decidual tissues and its involvement in the recruitment of circulating NK cells into the uterus during early pregnancy as well as its ability to contribute to vascular remodeling.
We found that chemerin is expressed at mRNA levels in the uterine compartment and that the primary source of this chemoattractant are EVT and ST cells, being the chemerin mRNA levels undetectable on DEC. Notably, we found that uterine ST cells from pregnant women express significantly higher amount of chemerin mRNA with respect to ST cells from fertile or menopause women. These results, together with the ability of ST cell primary cultures from pregnant women to release higher amount of chemerin with respect to ST cells from fertile non-pregnant or menopause women indicate that the expression and secretion of this chemoattractant in the uterus can be upmodulated during decidualization of endometrial stromal cells.
Among factors involved in the control of the good outcome of pregnancy, crucial actors are sex hormones and there is evidence indicating that numerical variations of NK cells in the decidua or in
the late secretory phase of menstrual cycle parallel progesterone levels (King 2000; Croy, van den
Heuvel et al. 2006). The effect of this hormone in the control of NK cell accumulation in the uterus
has been mainly attributed to its ability to induce endometrial decidualization.
Endometrial decidualization is a process associated with many functional and phenotypic modifications and an enhanced expression of CXCL9/Mig, CXCL10/IP-10 and
CX3CL1/Fractalkine has been described (Hannan, Jones et al. 2004; Kitaya, Nakayama et al. 2004;
Sentman, Meadows et al. 2004).
63

Moreover, a cyclical variability in the expression levels of chemokines found in the endometrium during endometrial breakdown, repair or embryo implantation as well as changes in the functional adhesiveness of pbNK cells to decidual vascular endothelial cells associated to early pregnancy
have been described (Chantakru, Wang et al. 2003; Jones, Hannan et al. 2004; van den Heuvel,
Horrocks et al. 2005).
In agreement with these observations, we found that treatment of ST cell primary cultures from pregnant, fertile non-pregnant or menopause women with progesterone and oestrogen results in a significant up-regulation of chemerin secretion. However, the levels of chemerin release by ST cells from fertile non-pregnant or menopause women even upon hormone stimulation were lower than those from pregnant ST cells, thus suggesting that besides progesterone and oestrogen other pregnancy-associated factors can also contribute to the regulation of this chemoattractant expression.
The molecular events involved in the regulation of chemerin expression and secretion are still poorly defined. In this regard, there are evidence indicating that chemerin expression can be upregulated in psoriatic lesions and in intestinal epithelial cells in response to the retinoid tazarotene
(Nagpal, Patel et al. 1997; Maheshwari, Kurundkar et al. 2009) and in the bone stromal cell line
ST2 after treatment with 1,25-dihydroxy-vitamin D3 and dexamethasone (Adams, Abu-Amer et al.
1999). Notably, all the signals presently known to regulate chemerin expression are initiated by
nuclear receptors. Further studies are required to better determine the signaling molecules responsible for the up-regulation of chemerin expression and secretion into distinct tissues including the decidualized uterine compartment.
We and others reported that several uterine chemokines are able to support pbNK cell migration through DEC and ST decidual tissues suggesting that recruitment of pbNK cells can contribute to
NK cell accumulation in the decidua during the first trimester of gestation (Santoni, Carlino et al.
2008). Chemerin has been shown to function as chemoattractant for circulating NK cells (Parolini,
64

Santoro et al. 2007); however, no evidence is yet available on the ability of chemerin to drive
pbNK cell migration through both DEC and ST cells in pregnant women. Our results by showing that chemerin can support pregnant women pbNK cell migration through both DEC and ST decidual cells provide novel information and strengthen the previous observations. Notably, we found that chemerin can support also dNK cell migration through ST cells, thus suggesting that this chemoattractant can contribute to both exit of pbNK cells from circulation for their recruitment in the uterine compartment and to finely tune dNK cell position and organization into specific focal areas of the decidua.
By analyzing ChemR23 expression on pbNK cells versus their dNK cell counterpart interestingly we found that the CD56 low
pbNK cell subset from pregnant woman exhibits high levels of
ChemR23 while the dNK cell counterpart is endowed with only low levels of this receptor. The ability of ChemR23 to elicit dNK cell migration through ST cells in response to chemerin together with its ability to trigger Erk activation in dNK cells when engaged by the ligand or specific mAb is to the best of our knowledge the first evidence indicating that ChemR23 is a functional receptor also for dNK cells.
The differential expression of ChemR23 on dNK adds a new phenotypic difference between pbNK cells and dNK cells, likely associated with the different activation/differentiation state of these two
NK cell populations.
In regard to the regulation of ChemR23 expression on NK cells, it has been reported that the expression of this receptor may undergo down-modulation when CD56 low
CD16
+
pbNK cell subset
is cultured in vitro with IL-2 or IL-15 (Parolini, Santoro et al. 2007), and much evidence indicate
that pregnant uterus is a good source of cytokines acting on NK cells including IL-15 (Verma,
Hiby et al. 2000).
The demonstration herein reported that human pbNK cells acquire a chemerin receptor repertoire similar to that of decidual NK cells when they contact ST cells indicates that, regardless of their
65

origin, it is likely that dNK cells are influenced by specific factors present in their local environment. Our data show that communication between NK cells and ST cells results in a downregulation of ChemR23 expression and thus in modulation of NK cell migratory phenotype. It is presently unknown whether the NK cell-stimulating signals delivered by decidualized ST cells are membrane associated and/or soluble factors. Our findings however, are in line with accumulating evidences indicating that signals provided by decidualized ST cells, including IL-15 and IL-11,
critically control uNK development and/or functional differentiation (Verma, Hiby et al. 2000;
Zourbas, Dubanchet et al. 2001; Ain, Trinh et al. 2004). In this regard, it has been reported that
incubation of CD16 pbNK cells with IL-15 or co-culture of pbNK cells with ST cells results in the
induction of a chemokine receptor pattern similar to that of uNK cells (Carlino, Stabile et al. 2008).
Moreover, culture of CD16
+
pbNK cells with conditioned medium derived from decidual ST cells results in conversion of CD16
+
pbNK cells into CD16
-
cells and in the up-regulation of CD9
expression, and these effects are clearly dependent on the TGFβ released by ST cells (Keskin,
Allan et al. 2007).
The establishment of pregnancy is highly dependent on the proper coordination of several vascular processes at the maternal–fetal interface to ensure an adequate blood flow in response to the increasing metabolic demands of the embryo. Disturbances in uterine blood supply are associated with first trimester miscarriages and third-trimester perinatal morbidity and mortality caused by pre-eclampsia and intrauterine growth restriction (IUGR). Several factors have been identified as important regulators of angiogenesis, including VEGF, PlGF, the angiopoietin family and proteases.
In this context, we provided the first evidence indicating that DEC express the chemerin receptor
ChemR23 and that once exposed to chemerin they undergo capillary-like tube formation, thus suggesting that chemerin in the uterus can partecipate also to the complex events leading to decidual vessel remodeling. These results are in agreement with the recently described ability of
66

chemerin to function as an angiogenic molecule for HUVEC or for vessels of adipose tissue
(Bozaoglu, Curran et al. 2010; Kaur, Adya et al. 2010). As a whole, our findings indicate that
chemerin production into the uterus is up-regulated during decidualization, and point out a crucial role for the chemerin/chemerin receptor axis in the recruitment, accumulation and the correct positioning of dNK cells in this organ as well as in vascular remodeling during early pregnancy
Fig.21).
Figure 21. Model of chemerin functions in the decidua during early pregnancy
During the first trimester of gestation, pregnancy-associated hormones induce an increase in chemerin production by uterine stromal cells. In the uterus chemerin have two main functions: i) it induces NK cell recruitment and accumualtion in the decidua and ii) it regulates the morphogenesis of uterine endothelial cells.
67

We would like to thank Prof. F. Tedesco and Prof. R. Bulla of the Department of Physiology and
Pathology, University of Trieste, Italy, and Prof. S. Sozzani from the Department of Biomedical
Sciences and Biotechnology, University of Brescia, Italy, for valuable collaboration to this work.
We are grateful to all the donors who contributed to this study and to the staff of Department of
Gynecology, "Sapienza" University of Rome and the Department of Reproductive and
Developmental Sciences, Institute for Maternal and Child Health, “Burlo Garofalo”, University of
Trieste for their precious contribution.
This work was supported by grants from Istituto Pasteur Fondazione Cenci Bolognetti, MIUR-
PRIN, Centro di Eccellenza BEMM and the European NoE EMBIC within FP6 (contract number
LSHN-CT-2004-512040).
68

Adams, A. E., Y. Abu-Amer, et al. (1999). "1,25 dihydroxyvitamin D3 and dexamethasone induce the cyclooxygenase 1 gene in osteoclast-supporting stromal cells." J Cell Biochem 74 (4): 587-595.
Ain, R., M. L. Trinh, et al. (2004). "Interleukin-11 signaling is required for the differentiation of natural killer cells at the maternal-fetal interface." Dev Dyn 231 (4): 700-708.
Albanesi, C., C. Scarponi, et al. (2009). "Chemerin expression marks early psoriatic skin lesions and correlates with plasmacytoid dendritic cell recruitment." J Exp Med 206 (1): 249-258.
Allen, S. J., B. A. Zabel, et al. (2007). "NMR assignment of human chemerin, a novel chemoattractant." Biomol NMR Assign 1 (2): 171-173.
Apps, R., L. Gardner, et al. (2008). "A critical look at HLA-G." Trends Immunol 29 (7): 313-321.
Apps, R., A. Sharkey, et al. (2011). "Genome-wide expression profile of first trimester villous and extravillous human trophoblast cells." Placenta 32 (1): 33-43.
Arita, M., F. Bianchini, et al. (2005). "Stereochemical assignment, antiinflammatory properties, and receptor for the omega-3 lipid mediator resolvin E1." J Exp Med 201 (5): 713-722.
Ashkar, A. A., G. P. Black, et al. (2003). "Assessment of requirements for IL-15 and IFN regulatory factors in uterine NK cell differentiation and function during pregnancy." J Immunol 171 (6): 2937-
2944.
Barnea, G., W. Strapps, et al. (2008). "The genetic design of signaling cascades to record receptor activation." Proc Natl Acad Sci U S A 105 (1): 64-69.
Bauer, S., J. Wanninger, et al. (2011). "Sterol regulatory element-binding protein 2 (SREBP2) activation after excess triglyceride storage induces chemerin in hypertrophic adipocytes."
Endocrinology 152 (1): 26-35.
Berg, V., B. Sveinbjornsson, et al. (2010). "Human articular chondrocytes express ChemR23 and chemerin; ChemR23 promotes inflammatory signalling upon binding the ligand chemerin(21-157)."
Arthritis Res Ther 12 (6): R228.
Berndt, S., S. Blacher, et al. (2009). "Chorionic gonadotropin stimulation of angiogenesis and pericyte recruitment." J Clin Endocrinol Metab 94 (11): 4567-4574.
Bondue, B., V. Wittamer, et al. (2011). "Chemerin and its receptors in leukocyte trafficking, inflammation and metabolism." Cytokine Growth Factor Rev 22 (5-6): 331-338.
Borzychowski, A. M., B. A. Croy, et al. (2005). "Changes in systemic type 1 and type 2 immunity in normal pregnancy and pre-eclampsia may be mediated by natural killer cells." Eur J Immunol
35 (10): 3054-3063.
69

Bozaoglu, K., K. Bolton, et al. (2007). "Chemerin is a novel adipokine associated with obesity and metabolic syndrome." Endocrinology 148 (10): 4687-4694.
Bozaoglu, K., J. E. Curran, et al. (2010). "Chemerin, a novel adipokine in the regulation of angiogenesis." J Clin Endocrinol Metab 95 (5): 2476-2485.
Bulla, R., A. Villa, et al. (2005). "VE-cadherin is a critical molecule for trophoblast-endothelial cell interaction in decidual spiral arteries." Exp Cell Res 303 (1): 101-113.
Bulmer, J. N. and G. E. Lash (2005). "Human uterine natural killer cells: a reappraisal." Mol
Immunol 42 (4): 511-521.
Bulmer, J. N., D. Pace, et al. (1988). "Immunoregulatory cells in human decidua: morphology, immunohistochemistry and function." Reprod Nutr Dev 28 (6B): 1599-1613.
Burrows, T. D., A. King, et al. (1994). "Expression of adhesion molecules by endovascular trophoblast and decidual endothelial cells: implications for vascular invasion during implantation."
Placenta 15 (1): 21-33.
Burrows, T. D., A. King, et al. (1995). "The role of integrins in adhesion of decidual NK cells to extracellular matrix and decidual stromal cells." Cell Immunol 166 (1): 53-61.
Carlino, C., H. Stabile, et al. (2008). "Recruitment of circulating NK cells through decidual tissues: a possible mechanism controlling NK cell accumulation in the uterus during early pregnancy."
Blood 111 (6): 3108-3115.
Cash, J. L., R. Hart, et al. (2008). "Synthetic chemerin-derived peptides suppress inflammation through ChemR23." J Exp Med 205 (4): 767-775.
Cataldo, N. A., T. K. Woodruff, et al. (1993). "Regulation of insulin-like growth factor binding protein production by human luteinizing granulosa cells cultured in defined medium." J Clin
Endocrinol Metab 76 (1): 207-215.
Chantakru, S., W. A. Kuziel, et al. (2001). "A study on the density and distribution of uterine
Natural Killer cells at mid pregnancy in mice genetically-ablated for CCR2, CCR 5 and the CCR5 receptor ligand, MIP-1 alpha." J Reprod Immunol 49 (1): 33-47.
Chantakru, S., C. Miller, et al. (2002). "Contributions from self-renewal and trafficking to the uterine NK cell population of early pregnancy." J Immunol 168 (1): 22-28.
Chantakru, S., W. C. Wang, et al. (2003). "Coordinate regulation of lymphocyte-endothelial interactions by pregnancy-associated hormones." J Immunol 171 (8): 4011-4019.
Charnock-Jones, D. S., P. Kaufmann, et al. (2004). "Aspects of human fetoplacental vasculogenesis and angiogenesis. I. Molecular regulation." Placenta 25 (2-3): 103-113.
Conti, P., P. Youinou, et al. (2007). "Modulation of autoimmunity by the latest interleukins (with special emphasis on IL-32)." Autoimmun Rev 6 (3): 131-137.
Crellin, N. K., S. Trifari, et al. (2010). "Human NKp44+IL-22+ cells and LTi-like cells constitute a stable RORC+ lineage distinct from conventional natural killer cells." J Exp Med 207 (2): 281-290.
70

Croy, B. A., S. Esadeg, et al. (2003). "Update on pathways regulating the activation of uterine
Natural Killer cells, their interactions with decidual spiral arteries and homing of their precursors to the uterus." J Reprod Immunol 59 (2): 175-191.
Croy, B. A., H. He, et al. (2003). "Uterine natural killer cells: insights into their cellular and molecular biology from mouse modelling." Reproduction 126 (2): 149-160.
Croy, B. A., M. J. van den Heuvel, et al. (2006). "Uterine natural killer cells: a specialized differentiation regulated by ovarian hormones." Immunol Rev 214 : 161-185.
Daly, D. C., I. A. Maslar, et al. (1983). "Prolactin production during in vitro decidualization of proliferative endometrium." Am J Obstet Gynecol 145 (6): 672-678.
Dawson, T. C., A. B. Lentsch, et al. (2000). "Exaggerated response to endotoxin in mice lacking the
Duffy antigen/receptor for chemokines (DARC)." Blood 96 (5): 1681-1684.
De Palma, G., G. Castellano, et al. (2011). "The possible role of ChemR23/Chemerin axis in the recruitment of dendritic cells in lupus nephritis." Kidney Int 79 (11): 1228-1235.
Di Santo, J. P. and C. A. Vosshenrich (2006). "Bone marrow versus thymic pathways of natural killer cell development." Immunol Rev 214 : 35-46.
Dietl, J., A. Honig, et al. (2006). "Natural killer cells and dendritic cells at the human feto-maternal interface: an effective cooperation?" Placenta 27 (4-5): 341-347.
Dietl, J., P. Ruck, et al. (1992). "Uterine granular lymphocytes are activated natural killer cells expressing VLA-1." Immunol Today 13 (6): 236.
Dimmeler, S. and A. M. Zeiher (2000). "Akt takes center stage in angiogenesis signaling." Circ Res
86 (1): 4-5.
Dosiou, C. and L. C. Giudice (2005). "Natural killer cells in pregnancy and recurrent pregnancy loss: endocrine and immunologic perspectives." Endocr Rev 26 (1): 44-62.
Drake, P. M., M. D. Gunn, et al. (2001). "Human placental cytotrophoblasts attract monocytes and
CD56(bright) natural killer cells via the actions of monocyte inflammatory protein 1alpha." J Exp
Med 193 (10): 1199-1212.
Du, X. Y., B. A. Zabel, et al. (2009). "Regulation of chemerin bioactivity by plasma carboxypeptidase N, carboxypeptidase B (activated thrombin-activable fibrinolysis inhibitor), and platelets." J Biol Chem 284 (2): 751-758.
El Costa, H., A. Casemayou, et al. (2008). "Critical and differential roles of NKp46- and NKp30activating receptors expressed by uterine NK cells in early pregnancy." J Immunol 181 (5): 3009-
3017.
El Costa, H., J. Tabiasco, et al. (2009). "Effector functions of human decidual NK cells in healthy early pregnancy are dependent on the specific engagement of natural cytotoxicity receptors." J
Reprod Immunol 82 (2): 142-147.
71

Ernst, M. C. and C. J. Sinal (2010). "Chemerin: at the crossroads of inflammation and obesity."
Trends Endocrinol Metab 21 (11): 660-667.
Fernekorn, U., E. C. Butcher, et al. (2004). "Functional involvement of P-selectin and MAdCAM-1 in the recruitment of alpha4beta7-integrin-expressing monocyte-like cells to the pregnant mouse uterus." Eur J Immunol 34 (12): 3423-3433.
Freud, A. G., B. Becknell, et al. (2005). "A human CD34(+) subset resides in lymph nodes and differentiates into CD56bright natural killer cells." Immunity 22 (3): 295-304.
Freud, A. G. and M. A. Caligiuri (2006). "Human natural killer cell development." Immunol Rev
214 : 56-72.
Galligan, C. L., W. Matsuyama, et al. (2004). "Up-regulated expression and activation of the orphan chemokine receptor, CCRL2, in rheumatoid arthritis." Arthritis Rheum 50 (6): 1806-1814.
Gonen-Gross, T., H. Achdout, et al. (2003). "Complexes of HLA-G protein on the cell surface are important for leukocyte Ig-like receptor-1 function." J Immunol 171 (3): 1343-1351.
Goralski, K. B., T. C. McCarthy, et al. (2007). "Chemerin, a novel adipokine that regulates adipogenesis and adipocyte metabolism." J Biol Chem 282 (38): 28175-28188.
Guillabert, A., V. Wittamer, et al. (2008). "Role of neutrophil proteinase 3 and mast cell chymase in chemerin proteolytic regulation." J Leukoc Biol 84 (6): 1530-1538.
Guimond, M. J., B. Wang, et al. (1998). "Engraftment of bone marrow from severe combined immunodeficient (SCID) mice reverses the reproductive deficits in natural killer cell-deficient tg epsilon 26 mice." J Exp Med 187 (2): 217-223.
Hanna, J., D. Goldman-Wohl, et al. (2006). "Decidual NK cells regulate key developmental processes at the human fetal-maternal interface." Nat Med 12 (9): 1065-1074.
Hanna, J., O. Wald, et al. (2003). "CXCL12 expression by invasive trophoblasts induces the specific migration of CD16- human natural killer cells." Blood 102 (5): 1569-1577.
Hannan, N. J., R. L. Jones, et al. (2004). "Coexpression of fractalkine and its receptor in normal human endometrium and in endometrium from users of progestin-only contraception supports a role for fractalkine in leukocyte recruitment and endometrial remodeling." J Clin Endocrinol Metab
89 (12): 6119-6129.
Harris, L. K. (2011). "IFPA Gabor Than Award lecture: Transformation of the spiral arteries in human pregnancy: key events in the remodelling timeline." Placenta 32 Suppl 2 : S154-158.
Hart, R. and D. R. Greaves (2010). "Chemerin contributes to inflammation by promoting macrophage adhesion to VCAM-1 and fibronectin through clustering of VLA-4 and VLA-5." J
Immunol 185 (6): 3728-3739.
Hazan, A. D., S. D. Smith, et al. (2010). "Vascular-leukocyte interactions: mechanisms of human decidual spiral artery remodeling in vitro." Am J Pathol 177 (2): 1017-1030.
72

Henderson, T. A., P. T. Saunders, et al. (2003). "Steroid receptor expression in uterine natural killer cells." J Clin Endocrinol Metab 88 (1): 440-449.
Hiby, S. E., J. J. Walker, et al. (2004). "Combinations of maternal KIR and fetal HLA-C genes influence the risk of preeclampsia and reproductive success." J Exp Med 200 (8): 957-965.
Hornung, D., I. P. Ryan, et al. (1997). "Immunolocalization and regulation of the chemokine
RANTES in human endometrial and endometriosis tissues and cells." J Clin Endocrinol Metab
82 (5): 1621-1628.
Hughes, T., B. Becknell, et al. (2010). "Interleukin-1beta selectively expands and sustains interleukin-22+ immature human natural killer cells in secondary lymphoid tissue." Immunity
32 (6): 803-814.
Hughes, T., B. Becknell, et al. (2009). "Stage 3 immature human natural killer cells found in secondary lymphoid tissue constitutively and selectively express the TH 17 cytokine interleukin-
22." Blood 113 (17): 4008-4010.
Iannone, F. and G. Lapadula (2011). "Chemerin/ChemR23 pathway: a system beyond chemokines."
Arthritis Res Ther 13 (2): 104.
Irwin, J. C., D. Kirk, et al. (1989). "Hormonal regulation of human endometrial stromal cells in culture: an in vitro model for decidualization." Fertil Steril 52 (5): 761-768.
Jones, R. L., N. J. Hannan, et al. (2004). "Identification of chemokines important for leukocyte recruitment to the human endometrium at the times of embryo implantation and menstruation." J
Clin Endocrinol Metab 89 (12): 6155-6167.
Kaur, J., R. Adya, et al. (2010). "Identification of chemerin receptor (ChemR23) in human endothelial cells: chemerin-induced endothelial angiogenesis." Biochem Biophys Res Commun
391 (4): 1762-1768.
Keskin, D. B., D. S. Allan, et al. (2007). "TGFbeta promotes conversion of CD16+ peripheral blood
NK cells into CD16- NK cells with similarities to decidual NK cells." Proc Natl Acad Sci U S A
104 (9): 3378-3383.
King, A. (2000). "Uterine leukocytes and decidualization." Hum Reprod Update 6 (1): 28-36.
King, A., N. Balendran, et al. (1991). "CD3- leukocytes present in the human uterus during early placentation: phenotypic and morphologic characterization of the CD56++ population." Dev
Immunol 1 (3): 169-190.
Kitaya, K., T. Nakayama, et al. (2004). "Spatial and temporal expression of ligands for CXCR3 and
CXCR4 in human endometrium." J Clin Endocrinol Metab 89 (5): 2470-2476.
Kitaya, K., T. Nakayama, et al. (2003). "Expression of macrophage inflammatory protein-1beta in human endometrium: its role in endometrial recruitment of natural killer cells." J Clin Endocrinol
Metab 88 (4): 1809-1814.
73

Kitaya, K., T. Yamaguchi, et al. (2007). "Post-ovulatory rise of endometrial CD16(-) natural killer cells: in situ proliferation of residual cells or selective recruitment from circulating peripheral blood?" J Reprod Immunol 76 (1-2): 45-53.
Kitaya, K., J. Yasuda, et al. (2000). "IL-15 expression at human endometrium and decidua." Biol
Reprod 63 (3): 683-687.
Koopman, L. A., H. D. Kopcow, et al. (2003). "Human decidual natural killer cells are a unique NK cell subset with immunomodulatory potential." J Exp Med 198 (8): 1201-1212.
Kopcow, H. D., D. S. Allan, et al. (2005). "Human decidual NK cells form immature activating synapses and are not cytotoxic." Proc Natl Acad Sci U S A 102 (43): 15563-15568.
Kralisch, S., S. Weise, et al. (2009). "Interleukin-1beta induces the novel adipokine chemerin in adipocytes in vitro." Regul Pept 154 (1-3): 102-106.
Kulig, P., B. A. Zabel, et al. (2007). "Staphylococcus aureus-derived staphopain B, a potent cysteine protease activator of plasma chemerin." J Immunol 178 (6): 3713-3720.
Kunkel, E. J. and E. C. Butcher (2002). "Chemokines and the tissue-specific migration of lymphocytes." Immunity 16 (1): 1-4.
Lash, G. E., S. C. Robson, et al. (2010). "Review: Functional role of uterine natural killer (uNK) cells in human early pregnancy decidua." Placenta 31 Suppl : S87-92.
Lash, G. E., B. Schiessl, et al. (2006). "Expression of angiogenic growth factors by uterine natural killer cells during early pregnancy." J Leukoc Biol 80 (3): 572-580.
Le Bouteiller, P. and M. P. Piccinni (2008). "Human NK cells in pregnant uterus: why there?" Am J
Reprod Immunol 59 (5): 401-406.
Le Bouteiller, P., J. Siewiera, et al. (2011). "The human decidual NK-cell response to virus infection: what can we learn from circulating NK lymphocytes?" J Reprod Immunol 88 (2): 170-
175.
Lebbink, R. J., T. de Ruiter, et al. (2006). "Collagens are functional, high affinity ligands for the inhibitory immune receptor LAIR-1." J Exp Med 203 (6): 1419-1425.
Lebbink, R. J., M. C. van den Berg, et al. (2008). "The soluble leukocyte-associated Ig-like receptor
(LAIR)-2 antagonizes the collagen/LAIR-1 inhibitory immune interaction." J Immunol 180 (3):
1662-1669.
Lee, C. L., P. C. Chiu, et al. (2010). "Glycodelin-A modulates cytokine production of peripheral blood natural killer cells." Fertil Steril 94 (2): 769-771.
Leonard, S., C. Murrant, et al. (2006). "Mechanisms regulating immune cell contributions to spiral artery modification -- facts and hypotheses -- a review." Placenta 27 Suppl A : S40-46.
Li, X. F., D. S. Charnock-Jones, et al. (2001). "Angiogenic growth factor messenger ribonucleic acids in uterine natural killer cells." J Clin Endocrinol Metab 86 (4): 1823-1834.
74

Lobo, S. C., S. T. Huang, et al. (2004). "The immune environment in human endometrium during the window of implantation." Am J Reprod Immunol 52 (4): 244-251.
Liu Z.J., T. Shirakawa, et al. (2003). "Regulation of Notch1 and Dll4 by vascular endothelial growth factor in arterial endothelial cells: implications for modulating arteriogenesis and angiogenesis" Mol. Cell. Biol. 23 (1):14–25.
Luangsay, S., V. Wittamer, et al. (2009). "Mouse ChemR23 is expressed in dendritic cell subsets and macrophages, and mediates an anti-inflammatory activity of chemerin in a lung disease model."
J Immunol 183 (10): 6489-6499.
Lydon, J. P., F. J. DeMayo, et al. (1995). "Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities." Genes Dev 9 (18): 2266-2278.
Maheshwari, A., A. R. Kurundkar, et al. (2009). "Epithelial cells in fetal intestine produce chemerin to recruit macrophages." Am J Physiol Gastrointest Liver Physiol 297 (1): G1-G10.
Male, V., A. Sharkey, et al. (2011). "The effect of pregnancy on the uterine NK cell KIR repertoire." Eur J Immunol 41 (10): 3017-3027.
Manaster, I., R. Gazit, et al. (2010). "Notch activation enhances IFNgamma secretion by human peripheral blood and decidual NK cells." J Reprod Immunol 84 (1): 1-7.
Manaster, I. and O. Mandelboim (2008). "The unique properties of human NK cells in the uterine mucosa." Placenta 29 Suppl A : S60-66.
Manaster, I. and O. Mandelboim (2010). "The unique properties of uterine NK cells." Am J Reprod
Immunol 63 (6): 434-444.
Manaster, I., S. Mizrahi, et al. (2008). "Endometrial NK cells are special immature cells that await pregnancy." J Immunol 181 (3): 1869-1876.
Mazella, J., S. Liang, et al. (2008). "Expression of Delta-like protein 4 in the human endometrium."
Endocrinology 149 (1):15–19.
Meder, W., M. Wendland, et al. (2003). "Characterization of human circulating TIG2 as a ligand for the orphan receptor ChemR23." FEBS Lett 555 (3): 495-499.
Migeotte, I., J. D. Franssen, et al. (2002). "Distribution and regulation of expression of the putative human chemokine receptor HCR in leukocyte populations." Eur J Immunol 32 (2): 494-501.
Moffett-King, A. (2002). "Natural killer cells and pregnancy." Nat Rev Immunol 2 (9): 656-663.
Moffett, A. and C. Loke (2006). "Immunology of placentation in eutherian mammals." Nat Rev
Immunol 6 (8): 584-594.
Moore, K. L. and L. F. Thompson (1992). "P-selectin (CD62) binds to subpopulations of human memory T lymphocytes and natural killer cells." Biochem Biophys Res Commun 186 (1): 173-181.
75

Muruganandan, S., S. D. Parlee, et al. (2011). "Chemerin, a novel peroxisome proliferator-activated receptor gamma (PPARgamma) target gene that promotes mesenchymal stem cell adipogenesis." J
Biol Chem 286 (27): 23982-23995.
Nagpal, S., S. Patel, et al. (1997). "Tazarotene-induced gene 2 (TIG2), a novel retinoid-responsive gene in skin." J Invest Dermatol 109 (1): 91-95.
Nakajima, H., K. Nakajima, et al. (2010). "Circulating level of chemerin is upregulated in psoriasis." J Dermatol Sci 60 (1): 45-47.
Naruse, K., G. E. Lash, et al. (2009). "Localization of matrix metalloproteinase (MMP)-2, MMP-9 and tissue inhibitors for MMPs (TIMPs) in uterine natural killer cells in early human pregnancy."
Hum Reprod 24 (3): 553-561.
Noyes, R. W., A. T. Hertig, et al. (1975). "Dating the endometrial biopsy." Am J Obstet Gynecol
122 (2): 262-263.
Oostendorp, J., M. N. Hylkema, et al. (2004). "Localization and enhanced mRNA expression of the orphan chemokine receptor L-CCR in the lung in a murine model of ovalbumin-induced airway inflammation." J Histochem Cytochem 52 (3): 401-410.
Ordi, J., G. Casals, et al. (2006). "Uterine (CD56+) natural killer cells recruitment: association with decidual reaction rather than embryo implantation." Am J Reprod Immunol 55 (5): 369-377.
Parlee, S. D., M. C. Ernst, et al. (2010). "Serum chemerin levels vary with time of day and are modified by obesity and tumor necrosis factor-{alpha}." Endocrinology 151 (6): 2590-2602.
Parolini, S., A. Santoro, et al. (2007). "The role of chemerin in the colocalization of NK and dendritic cell subsets into inflamed tissues." Blood 109 (9): 3625-3632.
Pinola, M., E. Saksela, et al. (1994). "Human NK cells expressing alpha 4 beta 1/beta 7 adhere to
VCAM-1 without preactivation." Scand J Immunol 39 (2): 131-136.
Poehlmann, T. G., A. Schaumann, et al. (2006). "Inhibition of term decidual NK cell cytotoxicity by soluble HLA-G1." Am J Reprod Immunol 56 (5-6): 275-285.
Rees, M. C., A. R. Heryet, et al. (1993). "Immunohistochemical properties of the endothelial cells in the human uterus during the menstrual cycle." Hum Reprod 8 (8): 1173-1178.
Roh, S. G., S. H. Song, et al. (2007). "Chemerin--a new adipokine that modulates adipogenesis via its own receptor." Biochem Biophys Res Commun 362 (4): 1013-1018.
Santoni, A., C. Carlino, et al. (2008). "Mechanisms underlying recruitment and accumulation of decidual NK cells in uterus during pregnancy." Am J Reprod Immunol 59 (5): 417-424.
Sargent, I. L., A. M. Borzychowski, et al. (2006). "NK cells and human pregnancy--an inflammatory view." Trends Immunol 27 (9): 399-404.
Sell, H., J. Laurencikiene, et al. (2009). "Chemerin is a novel adipocyte-derived factor inducing insulin resistance in primary human skeletal muscle cells." Diabetes 58 (12): 2731-2740.
76

Sentman, C. L., S. K. Meadows, et al. (2004). "Recruitment of uterine NK cells: induction of CXC chemokine ligands 10 and 11 in human endometrium by estradiol and progesterone." J Immunol
173 (11): 6760-6766.
Shimamura, K., M. Matsuda, et al. (2009). "Identification of a stable chemerin analog with potent activity toward ChemR23." Peptides 30 (8): 1529-1538.
Shimizu, N., A. Tanaka, et al. (2010). "Short communication: identification of the conformational requirement for the specificities of coreceptors for human and simian immunodeficiency viruses."
AIDS Res Hum Retroviruses 26 (3): 321-328.
Slukvin, II, V. P. Chernyshov, et al. (1994). "Differential expression of adhesion and homing molecules by human decidual and peripheral blood lymphocytes in early pregnancy." Cell Immunol
158 (1): 29-45.
Smith, S. D., C. E. Dunk, et al. (2009). "Evidence for immune cell involvement in decidual spiral arteriole remodeling in early human pregnancy." Am J Pathol 174 (5): 1959-1971.
Snapp, K. R., H. Ding, et al. (1998). "A novel P-selectin glycoprotein ligand-1 monoclonal antibody recognizes an epitope within the tyrosine sulfate motif of human PSGL-1 and blocks recognition of both P- and L-selectin." Blood 91 (1): 154-164.
Spessotto, P., R. Bulla, et al. (2006). "EMILIN1 represents a major stromal element determining human trophoblast invasion of the uterine wall." J Cell Sci 119 (Pt 21): 4574-4584.
Springer, T. A. (1994). "Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm." Cell 76 (2): 301-314.
Stepan, H., A. Philipp, et al. (2011). "Serum levels of the adipokine chemerin are increased in preeclampsia during and 6 months after pregnancy." Regul Pept 168 (1-3): 69-72.
Straszewski-Chavez, S. L., V. M. Abrahams, et al. (2004). "X-linked inhibitor of apoptosis (XIAP) confers human trophoblast cell resistance to Fas-mediated apoptosis." Mol Hum Reprod 10 (1): 33-
41.
Tabiasco, J., M. Rabot, et al. (2006). "Human decidual NK cells: unique phenotype and functional properties -- a review." Placenta 27 Suppl A : S34-39.
Takahashi, M., Y. Takahashi, et al. (2008). "Chemerin enhances insulin signaling and potentiates insulin-stimulated glucose uptake in 3T3-L1 adipocytes." FEBS Lett 582 (5): 573-578.
Tawia, S. A., L. A. Beaton, et al. (1993). "Immunolocalization of the cellular adhesion molecules, intercellular adhesion molecule-1 (ICAM-1) and platelet endothelial cell adhesion molecule
(PECAM), in human endometrium throughout the menstrual cycle." Hum Reprod 8 (2): 175-181.
Timonen, T. (1997). "Natural killer cells: endothelial interactions, migration, and target cell recognition." J Leukoc Biol 62 (6): 693-701.
Tokizawa, S., N. Shimizu, et al. (2000). "Infection of mesangial cells with HIV and SIV: identification of GPR1 as a coreceptor." Kidney Int 58 (2): 607-617.
77

Torry, D. S., J. Leavenworth, et al. (2007). "Angiogenesis in implantation." J Assist Reprod Genet
24 (7): 303-315.
Trundley, A. and A. Moffett (2004). "Human uterine leukocytes and pregnancy." Tissue Antigens
63 (1): 1-12.
Vacca, P., C. Cantoni, et al. (2010). "Crosstalk between decidual NK and CD14+ myelomonocytic cells results in induction of Tregs and immunosuppression." Proc Natl Acad Sci U S A 107 (26):
11918-11923.
Vacca, P., G. Pietra, et al. (2006). "Analysis of natural killer cells isolated from human decidua:
Evidence that 2B4 (CD244) functions as an inhibitory receptor and blocks NK-cell function." Blood
108 (13): 4078-4085.
Vacca, P., C. Vitale, et al. (2011). "CD34+ hematopoietic precursors are present in human decidua and differentiate into natural killer cells upon interaction with stromal cells." Proc Natl Acad Sci U
S A 108 (6): 2402-2407.
Valdes, G. and J. Corthorn (2011). "Review: The angiogenic and vasodilatory utero-placental network." Placenta 32 Suppl 2 : S170-175. van den Heuvel, M. J., J. Horrocks, et al. (2005). "Menstrual cycle hormones induce changes in functional interactions between lymphocytes and decidual vascular endothelial cells." J Clin
Endocrinol Metab 90 (5): 2835-2842.
Varla-Leftherioti, M., M. Spyropoulou-Vlachou, et al. (2005). "Lack of the appropriate natural killer cell inhibitory receptors in women with spontaneous abortion." Hum Immunol 66 (1): 65-71.
Verma, S., S. E. Hiby, et al. (2000). "Human decidual natural killer cells express the receptor for and respond to the cytokine interleukin 15." Biol Reprod 62 (4): 959-968.
Verma, S., A. King, et al. (1997). "Expression of killer cell inhibitory receptors on human uterine natural killer cells." Eur J Immunol 27 (4): 979-983.
Vermi, W., E. Riboldi, et al. (2005). "Role of ChemR23 in directing the migration of myeloid and plasmacytoid dendritic cells to lymphoid organs and inflamed skin." J Exp Med 201 (4): 509-515.
Weigert, J., F. Obermeier, et al. (2010). "Circulating levels of chemerin and adiponectin are higher in ulcerative colitis and chemerin is elevated in Crohn's disease." Inflamm Bowel Dis 16 (4): 630-
637.
Whitelaw, P. F. and B. A. Croy (1996). "Granulated lymphocytes of pregnancy." Placenta 17 (8):
533-543.
Wittamer, V., B. Bondue, et al. (2005). "Neutrophil-mediated maturation of chemerin: a link between innate and adaptive immunity." J Immunol 175 (1): 487-493.
Wittamer, V., J. D. Franssen, et al. (2003). "Specific recruitment of antigen-presenting cells by chemerin, a novel processed ligand from human inflammatory fluids." J Exp Med 198 (7): 977-985.
78

Wu, X., L. P. Jin, et al. (2005). "Human first-trimester trophoblast cells recruit CD56brightCD16-
NK cells into decidua by way of expressing and secreting of CXCL12/stromal cell-derived factor
1." J Immunol 175 (1): 61-68.
Yago, T., M. Tsukuda, et al. (1998). "IL-12 promotes the adhesion of NK cells to endothelial selectins under flow conditions." J Immunol 161 (3): 1140-1145.
Yamaguchi, T., K. Kitaya, et al. (2006). "Potential selectin L ligands involved in selective recruitment of peripheral blood CD16(-) natural killer cells into human endometrium." Biol Reprod
74 (1): 35-40.
Yang, D., O. Chertov, et al. (2001). "Participation of mammalian defensins and cathelicidins in anti-microbial immunity: receptors and activities of human defensins and cathelicidin (LL-37)." J
Leukoc Biol 69 (5): 691-697.
Yoshimura, T. and J. J. Oppenheim (2011). "Chemokine-like receptor 1 (CMKLR1) and chemokine
(C-C motif) receptor-like 2 (CCRL2); two multifunctional receptors with unusual properties." Exp
Cell Res 317 (5): 674-684.
Zabel, B. A., S. J. Allen, et al. (2005). "Chemerin activation by serine proteases of the coagulation, fibrinolytic, and inflammatory cascades." J Biol Chem 280 (41): 34661-34666.
Zabel, B. A., S. Nakae, et al. (2008). "Mast cell-expressed orphan receptor CCRL2 binds chemerin and is required for optimal induction of IgE-mediated passive cutaneous anaphylaxis." J Exp Med
205 (10): 2207-2220.
Zabel, B. A., L. Zuniga, et al. (2006). "Chemoattractants, extracellular proteases, and the integrated host defense response." Exp Hematol 34 (8): 1021-1032.
Zetter, B. R. (1998). "Angiogenesis and tumor metastasis." Annu Rev Med 49 : 407-424.
Zhao, L., Y. Yamaguchi, et al. (2011). "Chemerin158K protein is the dominant chemerin isoform in synovial and cerebrospinal fluids but not in plasma." J Biol Chem 286 (45): 39520-39527.
Zheng, L. M., D. M. Ojcius, et al. (1991). "Role of granulated metrial gland cells in the immunology of pregnancy." Am J Reprod Immunol 25 (2): 72-76.
Zourbas, S., S. Dubanchet, et al. (2001). "Localization of pro-inflammatory (IL-12, IL-15) and antiinflammatory (IL-11, IL-13) cytokines at the foetomaternal interface during murine pregnancy."
Clin Exp Immunol 126 (3): 519-528.
Zygmunt, M., F. Herr, et al. (2002). "Characterization of human chorionic gonadotropin as a novel angiogenic factor." J Clin Endocrinol Metab 87 (11): 5290-5296.
79