Answers to Mastering Concepts
7.1
1. What evidence enabled Watson and Crick to decipher the structure of DNA?
The evidence included Rosalind Franklin’s X-ray diffraction photo of a crystal of DNA,
plus Erwin Chargaff’s work that showed that DNA contains equal amounts of adenine
and thymine and equal amounts of cytosine and guanine.
2. Describe the components of DNA and its three-dimensional structure.
Nucleotides are the molecular subunits that make up DNA. Nucleotides are composed of
a deoxyribose sugar bonded to a phosphate and a nucleotide base (adenine, thymine,
cytosine, or guanine). The three-dimensional structure of DNA is a double helix, which
resembles a twisted ladder.
7.2
1. What is the relationship between a gene and a protein?
A gene is a strand of DNA that encodes a protein.
2. How do transcription and translation use genetic information?
Transcription uses the information in DNA to produce a strand of mRNA, and translation
uses this mRNA to produce a protein.
3. What are the three types of RNA?
Messenger RNA (mRNA) carries the DNA instructions for building the protein, transfer
RNA (tRNA) carries the appropriate amino acid to the ribosome, and ribosomal RNA
(rRNA) is the major component of a ribosome, the structure that assembles the amino
acids into proteins.
7.3
1. What happens during transcription?
In transcription, a copy of mRNA is made from a strand of DNA.
2. Where in the eukaryotic cell does transcription occur?
Transcription takes place within the nucleus of the cell.
3. What is the role of RNA polymerase in transcription?
RNA polymerase is the enzyme that uses the DNA template to build the mRNA strand.
4. What are the roles of promoter and terminator sequences in transcription?
The promoter signals the start of a gene, and the terminator signals the end of a gene.
5. How is mRNA modified before it leaves the nucleus of a eukaryotic cell?
Before mRNA leaves the nucleus of a eukaryotic cell, a cap is added to one end of the
molecule, a poly A tail is added to the other end, introns are removed, and exons are
spliced together.
7.4
1. What happens during translation?
During translation the amino acids are assembled into a protein.
2. Where in the cell does translation occur?
Translation occurs at ribosomes in the cell’s cytoplasm.
3. What are the steps of translation?
The steps of translation are initiation, elongation of the polypeptide, and termination.
4. How does a polypeptide fold into its finished shape?
Some regions of the protein are attracted to or repelled by each other, which changes the
protein’s shape; enzymes sometimes cut amino acids out of the chain, and sometimes
multiple polypeptides join together.
7.5
1. Which steps in protein synthesis require energy?
All steps of protein synthesis require energy.
2. Why do cells regulate which genes are expressed at any given time?
The production of proteins requires energy, so the cell only produces the proteins that are
required rather than all the proteins that are encoded in the DNA.
3. How do proteins determine whether a bacterial operon is expressed?
If the substrate is absent, a repressor protein binds to an operator and prevents the genes
in the operon from being transcribed. If the substrate is present, it binds to the repressor
protein, which detaches from the DNA and allows the genes to be transcribed.
4. What is the role of transcription factors in gene expression?
Transcription factors bind to certain DNA sequences to regulate transcription, for
example by preparing a promoter site to bind RNA polymerase. A gene is not expressed
in the absence of transcription factors.
5. What are some mechanisms by which eukaryotic cells control gene expression?
Gene expression can be regulated by controlling the availability of the DNA, for example
by keeping it coiled or attaching methyl groups to inactivate genes. Transcription factors
also regulate gene expression, as does the removal of introns. Messenger RNA can be
retained in the nucleus or rapidly degraded in the cytoplasm which would limit protein
production. If proteins are made they can be inactivated by not folding correctly or by
being degraded.
7.6
1. What are the types of mutations, and how does each alter the encoded protein?
A point mutation changes one or a few base pairs of genes. Point mutations include
substitution mutations (which replace one DNA base for another), insertions, and
deletions. A substitution mutation of a single nucleotide might change one amino acid in
the protein. Insertions or deletions in numbers other than multiples of three nucleotides
will shift the “reading frame” of the gene; these frameshift mutations might alter many
amino acids in the protein, drastically changing its shape and function. An insertion of
three nucleotides adds one amino acid to the encoded protein. A deletion of three
nucleotides removes one amino acid from the encoded protein.
2. What causes mutations?
Mutations are caused by DNA replication errors, errors during meiosis, and exposure to
chemicals or radiation.
3. How are mutations important tools in biological research?
Biologists can induce mutations to learn how genes normally function and to develop
new varieties of crop plants. Naturally occurring mutations can be used to trace the
evolution of viruses and other infectious agents.
7.7
1. How are viruses similar to and different from bacteria and eukaryotic cells?
Viruses are similar to bacteria and eukaryotic cells because they contain genetic material
and proteins. Viruses are different because they are smaller than cells and contain no
ribosomes or other organelles. Moreover, viruses do not have metabolism and they
cannot replicate on their own; they must infect a living host cell to replicate.
2. What features do all viruses share?
All viruses have genetic material and a protein coat.
3. Describe the five steps in viral replication.
First the virus must attach to the host cell (attachment). Next, the genetic material enters
the host cell (penetration and uncoating). The genetic material then stimulates the host to
produce multiple copies of the virus’ genetic material and proteins (synthesis). The host
cell then packages the genetic material into the protein coats (assembly) and prepares the
new virus particles for release from the host cell (release).
4. What is the source of energy and raw materials for the synthesis of viruses in a host
cell?
The host cell provides the energy and raw materials for the synthesis of more viruses.
7.8
1. How is a lysogenic viral infection similar to and different from a lytic cycle?
A lytic viral infection is similar to a lysogenic viral cycle in that both allow viruses to
reproduce. Whereas a lytic infection destroys a cell immediately, a lysogenic virus inserts
its DNA into the host chromosome, where it is carried on into daughter cells. Eventually
an environmental change triggers reproduction of viruses and the lysogenic virus follows
a lytic pathway, destroying the host cell.
2. What is a latent animal virus?
In a latent virus, the host’s cells are infected with the virus, but the virus is dormant and
not replicating.
3. Describe how HIV replicates in host cells.
HIV uses the enzyme reverse transcriptase to produce DNA from its RNA genome. The
resulting DNA inserts itself into the host cell's DNA. The production of new viruses
begins after a latent period. New viruses are released by budding.
4. How are some latent viral infections linked to cancer?
Latent viruses like the human papillomavirus signal host cells to divide, which can cause
cancer.
5. How do viruses enter plant cells and spread within a plant?
The most frequent cause of infection is through insect transmission, as feeding insects
move from plant to plant. Once the plant has been infected the virus replicates and
spreads via the plasmodesmata.
6. What are some symptoms of viral infection in plants?
Some symptoms include small dead spots on leaves, blotchy mottled leaves, abnormal
growth, and streaking in some flowers.
7.9
1. How are viral infections treated and prevented?
Viral infections are difficult to treat because the viruses infect living host cells. The best
weapon is the vaccine; however, some antiviral drugs can prevent viral replication in
infected cells.
2. Why are antibiotics ineffective against viruses?
Antibiotic attack the cell walls, ribosomes, or enzymes of bacteria. Viruses do not have
any of these structures.
7.10
1. How are viroids and prions different from viruses?
Viroids contain RNA only and no protein coat, while prions are only abnormally shaped
proteins without genetic information.
2. How do viroids and prions cause disease?
Viroids interfere with the production of important proteins. An abnormally folded prion
causes others to refold in a chain reaction that results in cell death.
7.11
1. What question about the FOXP2 gene were the researchers trying to answer?
Researchers wanted to know which mutations arose in the FOXP2 gene during human
evolution, and when those mutations occurred. They also wanted to know if these
mutations could be linked to human acquisition of language.
2. What insights could scientists gain by intentionally mutating the FOXP2 gene in a
developing human? Would such an experiment be ethical?
As just one example, researchers could mutate the FOXP2 gene so that it is nonfunctional at different stages of development to learn whether it is important through all
of development or just in a critical window. Such an experiment would not be ethical.
Answers to Write It Out Questions
1. Describe the three-dimensional structure of DNA.
DNA is a double helix that resembles a twisted ladder. In this molecule, the “twin rails”
of the ladder are alternating units of deoxyribose and phosphate, and the ladder’s rungs
are A-T and G-C base pairs joined by hydrogen bonds.
2. What is the function of DNA?
DNA is divided into genes that encode proteins.
3. Arrange the following objects in order from smallest to largest: nucleotide,
nitrogenous base, gene, nucleus, cell, codon, chromosome.
From smallest to largest, the order is nitrogenous base, nucleotide, codon, gene,
chromosome, nucleus, and cell.
4. List the three major types of RNA and their functions.
Messenger RNA (mRNA) carries the information that specifies a protein. Ribosomal
RNA (rRNA) combines with proteins to form a ribosome, the physical location of protein
synthesis. Transfer RNA (tRNA) molecules are “connectors” that bind mRNA codons at
one end and specific amino acids at the other. Their role is to carry each amino acid to the
ribosome at the correct spot along the mRNA molecule.
5. List the differences between RNA and DNA.
RNA nucleotides contain a sugar called ribose; DNA nucleotides contain a similar sugar
called deoxyribose. RNA has the nitrogenous base uracil, which behaves similarly to the
thymine in DNA - that is, both uracil and thymine form complementary base pairs with
adenine. RNA can be single-stranded; DNA is double-stranded. RNA can catalyze
chemical reactions, a role not known for DNA.
6. Define and distinguish between transcription and translation.
Transcription copies the information encoded in a DNA base sequence into the
complementary language of mRNA. Once transcription is complete and mRNA is
processed, the cell is ready to translate the mRNA message into a sequence of amino
acids that builds a protein.
7. Where in a eukaryotic cell do transcription and translation occur?
Transcription occurs in the nucleus, and translation occurs at ribosomes in the cytoplasm.
8. List the sequence of the mRNA molecules transcribed from the following template
DNA sequence: G G A A T A C G T C T A G C T A G C A
The complementary sequence is: CCUUAUGCAGAUCGAUCGU
9. Given the following partial mRNA sequence, reconstruct the corresponding DNA
template sequence: A G G A A A A C C C C U C U U A U U A U A G A U
The complementary sequence is: TCCTTTTGGGGAGAATAATATCTA
10. What is the minimum size of a gene that encodes a protein 1259 amino acids long?
1259 x 3 = 3,777 bases. Adding three bases for the stop codon brings the total to 3,780
bases. The gene would actually be longer, however, because of introns (if the gene is
from a eukaryotic cell) and bases for the leader sequence on the mRNA.
11. If a cell’s genome is analogous to a cookbook and a gene is analogous to a recipe,
what is an analogy for a genetic mutation? How could you incorporate viruses into this
cookbook analogy?
An analogy for a genetic mutation might be a substitution in the recipe or a missing
ingredient; another analogy might be a smudge on the recipe that makes a 3 look like an
8, which would alter how much of an ingredient is used. Likewise, small changes in a
gene might add or delete amino acids from the encoded protein. Viruses might be an
extra set of recipes inserted into the cookbook.
12. How can a mutation alter the sequence of DNA bases in a gene but not produce a
noticeable change in the gene’s polypeptide product? How can a mutation alter the amino
acid sequence of a polypeptide yet not noticeably alter the organism?
A mutation may alter the sequence of a gene but not produce a noticeable change in the
gene’s polypeptide sequence because multiple codons encode most amino acids. A
mutation may alter the amino acid sequence but not alter the phenotype because the
protein’s shape may not change, other proteins may take over the altered protein’s
function, or the protein may not be essential.
13. Parkinson disease causes rigidity, tremors, and other motor symptoms. Only 2% of
cases are inherited, and these tend to have an early onset of symptoms. Some inherited
cases result from mutations in a gene that encodes the protein parkin, which has 12
exons. Indicate whether each of the following mutations in the parkin gene would result
in a smaller protein, a larger protein, or no change in the size of the protein.
a. Deletion of exon 3
b. Deletion of six consecutive nucleotides in exon 1
c. Duplication of exon 5
d. Disruption of the splice site between exon 8 and intron 8
e. Deletion of intron 2
a) smaller protein; b) smaller protein; c) larger protein; d) larger protein; e) no change
14. Consult the genetic code to write codon changes that could account for the following
changes in amino acid sequence:
a. Tryptophan to arginine
b. Glycine to valine
c. Tyrosine to histidine
a) UGG to CGG; b) GGU to GUU; GGC to GUC; GGA to GUA; GGG to GUG; c) UAU
to CAU; UAC to CAC
15. What are some ways that cells regulate gene expression?
Gene expression can be regulated by controlling the availability of the DNA, for example
by keeping it coiled or attaching methyl groups to inactivate genes. Transcription factors
also regulate gene expression, as does the removal of introns. Messenger RNA can be
retained in the nucleus or rapidly degraded in the cytoplasm which would limit protein
production. If proteins are made they can be inactivated by not folding correctly or by
being degraded.
16. What events occur in each of the five stages of viral replication?
1) Attachment -- virus adheres to host cell receptor. 2) Penetration -- virus enters the cell.
3) Synthesis -- multiple copies of the viral genome and proteins are produced by the host
cell. 4) Assembly -- the genetic information is packaged in a protein coat. 5) Release -new viruses leave cell.
17. Distinguish between lytic and lysogenic infections.
A lytic viral infection is similar to a lysogenic viral cycle in that both allow viruses to
reproduce. Whereas a lytic infection destroys a cell immediately, a lysogenic virus inserts
its DNA into the host chromosome, where it is carried on into daughter cells. Eventually
an environmental change triggers reproduction of viruses and the lysogenic virus follows
a lytic pathway, destroying the host cell.
18. Your biology lab instructor gives you a Petri dish of agar covered with visible
colonies. Your lab partner says the colonies are viruses, but you disagree. How do you
know the colonies are bacteria?
Viruses do not produce colonies on agar; they require living host cells to reproduce.
Many bacteria, on the other hand, can live and reproduce using the nutrients present in
agar.
19. With a diameter of about 600 nm, mimiviruses are enormous compared with other
viruses. The mimivirus genome consists of about 1.2 million base pairs and encodes more
than 1000 genes—more than some bacteria. If you encountered a mimivirus-like object in
your research, what sorts of studies could you carry out to determine whether the object
was a virus or a bacterium?
Using an electron microscope, you could search for structures (such as ribosomes) that
occur in bacteria but not viruses. You could also use physiological tests to search for
evidence of metabolism (which would occur only in bacteria). You could try to inactivate
the object using antibiotics that kill bacteria, or you could attempt to culture the object on
agar.
20. Imagine a hybrid virus with the protein coat of virus X and the DNA of virus Y.
Will a host cell infected with this hybrid virus produce virus X, virus Y, a mix of virus X
and Y, or hybrid viruses? Explain your answer.
The host cell would produce virus Y since the capsid of virus X would contain no genetic
instructions.
21. Why do antibiotics such as penicillin kill bacteria but leave viruses unharmed?
Viruses lack the cell walls, ribosomes, and enzymes that antibiotic drugs target.
22. Several anti-HIV drugs are already on the market. List some reasons that we might
need even more new drugs to fight HIV in the future.
The main reason we may need more drugs to fight HIV is that when the virus transcribes
its RNA to DNA it doesn't have a proofreading step, which leaves many mutations that
could lead to drug resistance. Because the patient’s best chance of slowing disease
progress lies in a cocktail of drugs, having more drugs could be an advantage.
23. How is a biological virus similar to and different from a computer virus?
Like a computer virus, a biological virus can severely disrupt the functions of the host,
and it passes from human to human like a computer virus. It also needs a human host to
replicate, like a computer virus needs a computer program. However, biological viruses
mutate frequently. In addition, the information in a biological virus consists of
nucleotides, and reading this code results in the production of a physical substance
(DNA/RNA and proteins).
24. The National Center for Biotechnology Information maintains an online list of
viruses for which genome sequence data are available.
Choose one and describe some discoveries that have come from research on this virus.
[Answers will vary].
Answers to Pull It Together Questions
1. Why is protein production essential to cell function?
Cell structure and function depend on proteins. For example, enzymes are proteins that
are required for essential chemical reactions to occur within a cell. Without enzymes, the
cell could not synthesize ATP, which the cell uses for energy. In addition, proteins
embedded within cell membranes have several important functions such as adhesion, cell
recognition, and transport of water-soluble molecules; without protein production, new
cell membrane proteins could not be produced.
2. Where do promoters, terminators, stop codons, transcription factors, and RNA
polymerase fit into this concept map?
Both “transcription factors” and “RNA polymerase” can connect to “promoters” with
“bind to”. Both “promoters” and “terminators” can lead to “DNA” with the connecting
phrase “are non-coding sequences of”. “Promoters” can also lead to “Transcription” with
“signals the starting point for”. “Terminators” can also lead to “Transcription” with
“signals the end point for”. Similarly, “stop codons” can lead to “Translation” with “ends
the process of”.
3. How would viruses fit into this concept map?
“Viruses” could lead to “Transcription” and “Translation” with the connecting phrase
“rely on a host for”. “Viruses” could also lead to “RNA” with the connecting phrase
“genomes are sometimes”.
4. Use the concept map to explain why a mutation in DNA sometimes causes protein
function to change.
A mutation is a change in the DNA sequence. If the change in the DNA sequence leads
to a change in the amino acid sequence that it encodes, there will be a change in the
protein produced. Therefore, mutations could lead to change in protein structure, which
means a change in protein function. If the mutation is neutral, the mutation encodes the
same amino acid sequence, and there would be no change in protein function.