D
DN
NA
A FFiinnggeerrpprriinntt LLaabb
Crime Scene DNA (SINGLE STRANDED FOR ALL):
AAATTTCTATCTTAAGATCTCAGGATCCTTGGATCCGGAGCGGATCTAGCTAGGATCCGGCATAATGACGATCGATTTCGATTCCAGGCCTCTTAAGTGGCTAGGCAGGCGGATAGGATCCGATT CGGATCCAGGGACTTAAGTCGGCGGATCAGGATCCCCGATCCTTAGCTGCGTGGTTCCAACGTCTGCCTTAAGGAATTGACTCAGCACCCTTAAGCTAC
Suspect 1 DNA:
AAATTTCTATCTTAAGATCTCAGGATCCTTGGATCCGGAGCGGATCTAGCTAGGATCCGGCATAATGACGATCGATTTCGATTCCAGGCCTCTTAAGTGGCTAGGCAGGCGGATAGGATCCGATT CGGATCCAGGGACTTAAGTCGGCGGATCAGGATCCCCGATCCTTAGCTGCGTGGTTCCAACGTCTGCCTTAAGGAATTGACTC AGCACCCTTAAGCTAC
Suspect 2 DNA:
AAATTTCTATCTTAAGATCTCAGGATCCTTGGATCCGGAGCGGATCTAGCTAGGATCCGGCATAATGACGATCGATTTCGATTCCAGGCCTCTTAAGTGGCTAGGCAGGCGGATAGGATCCGATT CGGATCCAGGGACTTAAGTCGGCGGATCAGGATCCCCGATCCTTAGCTGCGTGGTTCCAACGTCTGCCTTAAGGATCCGACTCAGCACCCTTAAGCTAC
You have just received evidence from Detective Jo. Suspect 1 and 2 were caught leaving the murder scene in which a Mr. Sugiyama was found brutally bludgeoned to death.
Skin samples were taken from under Mr. Sugiyama’s right Index finger and are believed to be from the suspect that did the dastardly deed. You send the crime scene skin sample along
with skin samples from Suspect 1 and 2 to DNA lab for further analysis,
Due to a budget shortfall there weren't enough funds to maintain the DNA cutting and sorting machine (electrophoresis). DRAT However, the DNA sequencing machine was still
half working and the forensic pathologist was able to get single stranded sequences of the DNA from the crime scene and the two suspects, He was able to send you two copies apiece of
each sample (lucky you-one set is pictured above the other set is below).
1. Pencil-mark where to cut up the DNA in to fragments using the restriction enzyme EcoR1. This means to look for the sequence CTTAAG and make the c u t between the A and G
(CTTAA||G). Do the actual cuts later for the Crime scene, Suspect 1 and Suspect 2.
Questions:
1. How do the pencil marks compare between the 3 strands of DNA?
2. How much difference in DNA is there between people? (Hint: how much difference is there between humans and Chimps?)
2. Sometimes the results from using one restriction enzyme are not enough (the results were inconclusive). Since you have one more DNA sample each, repeat steps 1 & 2 using the
restriction enzyme BamH1 Instead of EcoRI. BamH1 makes the cut at GGATCC (GGATC\\C) make the pencil marks first before you cut.
3. Cut the DNA into fragments; make sure they are kept in separate piles.
You now have to sort your DNA fragment according to size; unfortunately the electrophoresis machine is still broken - double DRAT! You'll have to do it by hand. Get your Crime scene
DNA fragments first and measure each fragment to the nearest mm. To determine how far each fragment would have traveled in a working electrophoresis machine, use this formula
((90-mm) X 3). Write the number on the back of each fragment. EX: if the piece is 22mm long then the answer is (90-22) X 3 = 204.
4. Get all your fragments for the Crime scene and a piece of paper and a ruler and actually tape on to the paper where all the fragments would be (all the fragments from one source should be
taped in one column - this will end up looking like a graph of all the fragments over the heading Crime scene EcoR1. (If some of the fragments overlap your column, Just fold it over.) Your
talented instructor will show you an example. Graph the fragments on the same paper (you should have SIX graphs three from each restriction enzyme- since the first 3 are all the
same just graph one of the first three – but all of the last three – total of 4 graphs on one page).
Crime Scene DNA (SINGLE STRANDED FOR ALL):
AAATTTCTATCTTAAGATCTCAGGATCCTTGGATCCGGAGCGGATCTAGCTAGGATCCGGCATAATGACGATCGATTTCGATTCCAGGCCTCTTAAGTGGCTAGGCAGGCGGATAGGATCCGATT CGGATCCAGGGACTTAAGTCGGCGGATCAGGATCCCCGATCCTTAGCTGCGTGGTTCCAACGTCTGCCTTAAGGAATTGACTCAGCACCCTTAAGCTAC
Suspect 1 DNA:
AAATTTCTATCTTAAGATCTCAGGATCCTTGGATCCGGAGCGGATCTAGCTAGGATCCGGCATAATGACGATCGATTTCGATTCCAGGCCTCTTAAGTGGCTAGGCAGGCGGATAGGATCCGATT CGGATCCAGGGACTTAAGTCGGCGGATCAGGATCCCCGATCCTTAGCTGCGTGGTTCCAACGTCTGCCTTAAGGAATTGACTCAGCACCCTTAAGCTAC
Suspect 2 DNA:
AAATTTCTATCTTAAGATCTCAGGATCCTTGGATCCGGAGCGGATCTAGCTAGGATCCGGCATAATGACGATCGATTTCGATTCCAGGCCTCTTAAGTGGCTAGGCAGGCGGATAGGATCCGATT CGGATCCAGGGACTTAAGTCGGCGGATCAGGATCCCCGATCCTTAGCTGCGTGGTTCCAACGTCTGCCTTAAGGATCCGACTCAGCACCCTTAAGCTAC
ANALYSIS: How do the graphs of the DNA fragments compare between the EcoR1 fragments? Also do the same for the BamH1 fragments.
Which suspect is probably the killer - what is your evidence?
Questions:
3 . What do you call EcoR1 and BamH1?
4. What is different about EcoR1 and BamH1?
5. How do you know that Suspect 1 and Suspect 2 are not identical twins?
6. If you were to compare Chimpanzee DNA to the Suspects DNA, would it look more similar or more different than the suspect'?
7. The results from which of the two enzymes are inconclusive?
8. Give a reason why using one enzyme gave you inconclusive results while using the other you could tell the difference.