Supplementary Materials and Methods
Page 1 / 13
Supplementary Materials and Methods
Sequences of PCR primers.
Forward primer:
#48-LacZ-TC
5'-DIG-#48-LacZ-TC
TCAGCCGCTACAGTCAACAG
5’-DIG-TCAGCCGCTACAGTCAACAG
gfp1
GACGTAAACGGCCACAAGTT
gfpM
AGGTGTCGACGCGTATTCGCTAGCGCTACCGGTCGCsC
(s
FITC-21cor-3’10P
FITC-CCCGTGCCCTGGCCAACCCTC
Reverse primer:
pabox4
5'-DIG-pabox4
= phosphorothioate linkage)
GTAAAACCTCTACAAATGTGGTATGGCTGA
5’-DIG-GTAAAACCTCTACAAATGTGGTATGGCTGA
gfp7
GAAGTCGTGCTGCTTCATGTGG
These primers were obtained from Eurofins MWG GmbH.
Plasmids and oligodeoxynucleotides.
Plasmid pCMV.LacZs31δGFP (7832 bp) carried the target locus and a neomycin resistance
gene (Kanr) (Fig. 1). Zinc-finger nucleases GZF1-N, GZF3-N, GZF1-KO, and GZF3-KO
were encoded by the following plasmids: pRK5.GZF1-N.I538V (5641 bp), pRK5.GZF3N.I499A (5641 bp), pRK5.GZF1-N.D450AG (5644 bp), and pRK5.GZF3-N.D450AG (5644
bp) where D450AG describes the inactivating mutation in the active site of the FokI nuclease
domain. The backbone-only version pRK5 (4661 bp) served as a negative control.
pRK5.LHA-Sce1[1] encoded the homing endonuclease I-SceI as positive control for the
effect of DBS induction. The linearized dephosphorylated plasmid pUC.Zgfp[1] provided a
dsDNA matrix as repair matrix positive control (further sequence informations in Fig. S1).
The ssODNs 3-1corr (112-mer; gel-purified 98%) and 3-1scr (112-mer; gel-purified 99%)
were received from Eurofins MWG GmbH, the biotinylated versions 3-1corr-BdT (112-mer;
Supplementary Materials and Methods
Page 2 / 13
gel-purified 96%) and 3-1c-s-BdT (113-mer; gel-purified 85%) were obtained from
Eurogentec S.A.. As transfection controls, the fluorescently-labeled ssODN FITC-21cor3’10P[2] (Eurofins MWG GmbH), and pDsRed-Express-N1 (4689 bp) were used.
pAV.Zgfp.DsRed2 (8378 bp) served as a digestion control in the capture assays.
All plasmids were grown in E.coli strain XL2-Blue cells (Stratagene; Agilent Technologies
Sales & Services GmbH & Co. KG), and DNA preparations were done with plasmid
preparation kits (QIAGEN GmbH) according to the instructions of the supplier.
Cell culture.
The HEK293-derived 293/3-1 cell line harbors pCMV.LacZs31δGFP as single-copy target
locus.[1] Cell cultures were expanded in DMEM (Gibco, Invitrogen GmbH) supplemented
with 10% fetal calf serum (FCS; PAA), 2 mM L-Glutamine (Gibco Invitrogen GmbH) and
0.5 mg Geneticin (G-418; Gibco Invitrogen GmbH) per ml to select for the transgene locus.
In preparation for each transfection experiment, cells were re-activated from frozen aliquots
and maintained in medium without Geneticin.
Transfections.
Any experiment employing a nuclease and a repair matrix was carried out as an individual
sample according to a two-step transfection protocol. First, the nuclease expression plasmids
were nucleofected, and two hours later, the repair matrices were transfected via calcium
phosphate-mediated coprecipitation. Nucleofection was done as follows: Per cuvette, 100 µl
of nucleofector solution contained a total of 5 µg of plasmid DNA and 1.5 × 106 cells
(passaged 24 h before the procedure). The Amaxa® Nucleofector® Kit V (Lonza Cologne AG)
was used with program A23.
For each nuclease combination, 4 different calcium phosphate coprecipitates were transfected:
mock, 3-1scr, 3-1corr, and dsDNA matrix. To this end, cells of one setting were split into four
Supplementary Materials and Methods
Page 3 / 13
24-wells each with a final volume of 500 µl of cell culture medium. For every 24-well,
calcium phosphate coprecipitations were generated by incubating 0.5 µg of DNA in 60 µl of
precipitation buffer[3] with 8.6 µl of 1 M CaCl2. On day 2, cells were passaged from 24-wells
to 6-wells. Five days later 50,000 total events were analyzed by FACS. In case of the two out
of the nine experiments where also expression of the nucleases was evaluated via intracellular
HA staining, cells were passaged on day 1.
The following accompanying transfection controls were carried out: FITC-21cor-3’10P was
the surrogate to control the reproducibility of the ssODN transfections. To gain insight into
the transfections of the nuclease expression plasmids, half of the input plasmids were
substituted with pDsRed-Express-N1 in settings with both functional ZFNs. At the early timepoint 5 h post nucleofection, the frequencies of living FITC-positive, DsRed-Express-N1positive and double-positive cells were measured by FACS evaluating 50,000 total events. In
such combined transient transfection protocols, it is rather difficult to define which relative
expression levels are relevant to gene repair. Therefore, these control samples served as a
measure for protocol reproducibility, and it was determined that if any of these three
categories showed rates <10%, all samples of the corresponding experiment were to be
dismissed (data not shown).
For gene correction experiments with biotinylated ssODNs assessing their fate, the
experiment settings were scaled up as follows: Cells of three cuvettes were transferred to one
T25 flask with a final volume of 7 ml of cell culture medium. For each T25 flask, the
corresponding calcium phosphate coprecipitations employed 7.5 µg of biotinylated ssODNs
in 900 µl of precipiation buffer mixed with 129 µl of 1 M CaCl2. EGFP-positive and -negative
cells were sorted on day 2.
Supplementary Materials and Methods
Page 4 / 13
Intracellular staining of nucleases via an Influenza hemagglutinin (HA) tag.
To examine the expression of the functional and non-functional ZFNs during the repair
experiments, the presence of the HA tag was scrutinized in two out of the nine experiments.
Transfected cells were detached about 24 h after transfection and 1/6 of the cells was used for
the HA staining; 1/3 of the cells was passaged to a 6-well for determining the correction
frequencies on day 7. The Inside stain Kit (Miltenyi Biotec GmbH) and the Anti-HA FITC
(Miltenyi Biotec GmbH) were used according to the instructions of the manufacturer,
however, all volumes were scaled down 5-times. 10,000 total events were analyzed by FACS.
FACS analysis.
Transfection rates and repair efficiencies were evaluated with a BD FACSort™ flow
cytometer System (Becton Dickinson GmbH). Preparation of the cells for the FACS
measurements and the analyses were done as described previously.[2]
Cell sorting.
Cells were sorted with a BD FACSAria™ Cell Sorting System using Firmware version 1.8
(Becton Dickinson GmbH). Sample preparations and FACS equipment have been described
previously.[4]
Cells were sorted for two different purposes:
(i) Analysis of the repair fidelity. Corrected transgene loci derived from living, EGFP-positive
cells were sequenced (Fig. S3). 100 EGFP-positive cells each were sorted into 4 PCR tubes.
For the purity control, cells from one of the PCR tubes were directly re-analyzed without
staining dead cells. Thus, the purity values below describe minimal purities, because cells lose
EGFP molecules when the intactness of their membranes has been compromised during the
sorting process. Purities of the sorted fractions were as follows:
Supplementary Materials and Methods
experimental
run
Page 5 / 13
EGFP(+)
EGFP(+)
EGFP(+)
EGFP(+)
GZF1-N + GZF3-N
I-SceI
GZF1-N + GZF3-N
I-SceI
3-1corr
3-1corr
dsDNA matrix
dsDNA matrix
EGFP(–)
untransfected
4
n.d.
71%
53%
92%
83%
7
n.d.
81%
55%
85%
74%
9
n.d.
94%
78%
89%
95%
(ii) Assessment of the fate of transfected biotinylated ssODNs. Living, EGFP-positive and
EGFP-negative cells were analyzed (Fig. 3). Purities of the sorted cell fractions were analyzed
before the cells were re-sorted to distribute them (250 cells for experiment I, 550 cells for
experiment II) into PCR tubes containing lysis buffer. From the remaining sorted EGFPnegative cells, gDNA were prepared. Purities (see explanation above) of the sorted cell
fractions were as follows:
experimental
run
EGFP(–)
EGFP(–)
EGFP(+)
GZF1-N + GZF3-N
GZF1-N + GZF3-N
GZF1-N + GZF3-N
3-1c-s-BdT
3-1corr-BdT
3-1corr-BdT
EGFP(–)
untransfected
I
>99.9%
>99.9%
>99.9%
93%
II
>99.9%
>99.9%
>99.9%
92%
PCR amplification of the target loci from EGFP-positive cells for quality control of
targeted gene correction.
Hundred EGFP-positive cells of the three independent experiments 4, 7, and 9 were sorted
directly into PCR tubes, and cells were prepared as described previously.[4] Targeted loci
were amplified by PCR with PfuTurbo Hotstart DNA polymerase and primers #48-LacZ-TC
and pabox4 (Fig. S3).
Supplementary Materials and Methods
Page 6 / 13
Capture assay[4] and analysis of biotinylated DNA fragments.
Basically, biotinylated DNA fragments were detected after capturing on streptavidin-coated
beads by PCR.
To minimize loss of gDNA fragments during standard gDNA preparations, e.g., by adsorption
to tube walls, cells of the samples shown in Fig. 3 were directly sorted into 5 µl of 4 °C-cold
lysis buffer (2.5 M NaCl, 0.1 M EDTA, 0.01 M Tris-base, adjusted to pH 10.0 with NaOH;
before use, the buffer was supplemented with 5% DMSO and 1% Triton-X100 and cooled at
4 °C for at least 1 h). For each sample, triplicates of 250 cells each (experiment I) or 550 cells
each (experiment II) were sorted. Cells were incubated in the lysis buffer at 4 °C overnight.
Then, the 5-µl samples were digested for at least 4 h at 37 °C with AflIII and BsrGI after
addition of 95 µl of digestion mixes which were assembled as follows: 6.66 µl of 10× buffer
NEB2, 3.33 µl of 10× buffer NEB3, 1 µl of 100× bovine serum albumin (BSA), 0.6 µl (≙ 3
units) of AflIII, 0.3 µl (≙ 3 units) of BsrGI (all reagents from New England Biolabs), 0.1 µl
of polyadenylic acid (Sigma-Aldrich GmbH; working concentration: 5 µg/µl), 83.0 µl of H2O
(Aqua ad iniectabilia Braun, B. Braun Melsungen AG). In parallel, completeness of digestion
was controlled by adding the plasmid pAV.Zgfp.DsRed2 (8378 bp) to a tube with sorted
untransfected cells. If this control digestion was complete, aliquots of the experiment samples
each representing 50 cells were purified with the QIAquick PCR purification kit (QIAGEN
GmbH). To control whether the samples contained digested DNA, a 35-cycle PCR specific
for the transgene locus was carried out (primer pair #48-LacZ-TC / gfp7). The remainders of
the samples (experiment I: 200 cells; experiment II: 500 cells) were stored at -20 °C until use
in capture experiments. Capture experiments were carried out with magnetic StreptavidinBeads MyOne C1 (Invitrogen GmbH). The internal control (IC)[4] was added to each sample
(experiment I: 200 molecules; experiment II: 500 molecules) except the H2O control.
Incubations were carried out under constant rotation at 4 °C overnight with 12.5 µg of beads
in 1× wash buffer (1 M NaCl , 10 mM Tris-HCl pH 7.5, 1mM EDTA, 0.1% BSA). After
Supplementary Materials and Methods
Page 7 / 13
incubation, samples were washed 4-times with 100 µl of 1× wash buffer. In case of NaOH
treatment, beads were additionally washed 2-times with 100 µl of 0.1 M NaOH / 50 mM NaCl
solution and once with 100 µl of 1× wash buffer. A final wash was done with 100 µl of 0.1%
BSA solution. Beads were then resuspended in 10 µl of Aqua ad iniectabilia and transferred to
PCR tubes, and fragments captured on streptavidin-coated beads were amplified (see below).
For the analysis of gDNA from EGFP-negative cells in capture experiments (Figs. 4, S4),
gDNA were isolated from sediments of sorted EGFP-negative cells using the Wizard
Genomic DNA Purification Kit (Promega GmbH) according to the manufacturer’s
instructions. gDNAs were digested with AflIII and BsrGI. 250 ng of digested gDNAs were
incubated in 1× wash buffer with 12.5 µg of streptavidin-coated beads at 4 °C overnight. If
for one sample two or three PCRs were carried out in parallel, the capture reaction setting was
scaled up accordingly. The washing procedure was as described above.
Captured fragments with the beads attached were amplified by PCR in 50-µl reactions using
the Taq PCR Polymerase System (QIAGEN GmbH). Primer pairs #48-LacZ-TC / gfp7 and
gfp1 / gfp7 were employed in PCRs with 40 and 35 cycles, respectively, under the following
conditions: 96 °C for 3 min; cycling: 96 °C for 30 s, 54 °C for 45 s, and 72 °C for 45 s; 72 °C
for 3 min (Stratagene Robocycler Gradient 40). When IC was included, its specific forward
primer gfpM was added to the primer pair 48-LacZ-TC / gfp7. Products were separated in
1.5% agarose gels and stained with ethidium bromide.
To estimate how many targeted alleles harbor an unintendedly inserted biotinylated ssODN
(Fig. S5), captured gDNA fragments were treated with NaOH prior to PCR amplification. The
189-bp PCR product was generated from a region downstream of the DSB site (primer pair
gfp1 / gfp7). This EGFP locus-specific fragment starting 42 bp downstream of the binding
site of GZF1-N was chosen to represent the captured fragments independently of their
respective DSB repair outcome, because the NHEJ deletions were <40 bp in ~90% of the
cases. Reference samples utilizing 100, 500, and 1500 genome copies of the 293/3-1 cells
Supplementary Materials and Methods
Page 8 / 13
were carried out in parallel, and the PCR products were separated on a 1.5% agarose gel
stained with ethidium bromide. The signals were evaluated yielding an integrated density
value (IDV) for each PCR product. For the calculation, one of the positive controls (Fig. S5;
lane 11) which yielded a signal similar to that from the capture assay was used as reference.
For each PCR with captured fragments, beads were initially offered 250 ng of gDNA which
corresponded to ~28,000 genome copies and thus—due to the single-copy situation of the
transgene—to as many target locus molecules. Based on these informations, the percentage of
target loci modified by incorporated ssODNs (TLmi) was calculated as follows:
 IDV S  GCNR
 100% 
TLmi = 
,
 2 
IDV R
 GCNO 

where IDVS represents integrated density value of the sample, IDVR represents the integrated
density value of the reference positive control, GCNR represents the genomic copy number in
the reference positive control, factor 2 corrects for the loss of one of the two original DNA
template strands during the NaOH treatment, and GCNO represents the genomic copy
numbers introduced into the bead-capture assay.
PCR amplification of targeted loci from EGFP-negative cells without bead-capturing.
For the PCR analyses shown in Figs. 4e, 4f gDNAs either were left undigested or were
digested with AseI or DraI (New England Biolabs GmbH). Digested gDNAs were purified
with QIAquick PCR Purification Kit (QIAGEN GmbH). 100 ng of gDNA (corresponding to
~11,100 target alleles) served as template for the PCR using Stratagene PfuTurbo Hotstart
DNA polymerase (Agilent Technologies Sales & Services GmbH & Co. KG) and primers
#48-LacZ-TC / gfp7. PCR conditions were as follows: 96 °C for 5 min; 94 °C for 1 min, 65
°C for 45 s, and 72 °C for 90 s (45 cycles; note that after 35 cycles, an aliquot was removed
Supplementary Materials and Methods
Page 9 / 13
for gel analysis; the materials from the 45-cycle PCRs were utilized for the sequence
analyses); 72 °C for 7 min. PCR products were separated in 1.5% agarose gels and stained
with ethidium bromide.
In vitro assay of zinc-finger nuclease activity.
DIG-labeled fragments for the in vitro cut assay were generated by PCR under the following
conditions: Stratagene PfuTurbo Hotstart DNA polymerase (Agilent Technologies Sales &
Services GmbH & Co. KG) was used with primers #48-LacZ-TC, 5’-DIG-#48-LacZ-TC,
pabox4, and 5’-DIG-pabox4. The 50-µl reactions were supplemented with 1.5 mM MgCl2. As
template served 0.2 ng of PCR product derived from the target locus of the 293/3-1 cells with
primer pair #48-LacZ-TC / pabox4. Reactions were carried out in a Stratagene Robocycler
Gradient 40 under the following conditions: 96 °C for 5 min; 94 °C for 1 min, 64 °C for 1
min, and 72 °C for 2 min (25 cycles); 72 °C for 3 min. Alternatively, 20 ng of gDNA and 0.1
ng of pCMV.LacZs31δGFP were used as templates in a 35-cycle PCR and a 25-cycle PCR,
respectively. DIG-labeled fragments were purified with the QIAquick PCR purification kit
(QIAGEN GmbH) and quantitated on an ethidium bromide-stained agarose gel.
For producing the ZFNs, 1.4 µg of SalI-linearized plasmid was incubated at 25 °C for 2 h in a
final volume of 10 µl containing 6 µl of TNT® SP6 High-Yield Protein Expression System
lysate (Promega GmbH). The in vitro cut assays (final volume: 10 µl) consisted of 1 µl of
freshly generated ZFNs, 1× NEB4 buffer (New England Biolabs (NEB) GmbH), 50 mM
NaCl (Merck KGaA), and 250 ng of plasmid DNA or 10 ng of DIG-labeled PCR fragment.
Digestions were carried out at 37 °C for 1 h. For gel analysis of products from reactions with
plasmid DNA, 1 µl of a digestion reaction was mixed with 0.15 µl of 20% SDS solution, 0.3
µl of 0.5 M EDTA pH 8 and 4.55 µl of H2O, incubated at room temperature for 5 min, mixed
with 2 µl of loading buffer, and loaded onto the gel. To adjust salt and protein concentrations
in the control samples, 1 µl of a template-free TNT lysate was added. Products were separated
Supplementary Materials and Methods
Page 10 / 13
in 0.8% agarose gels run in 1× modified TAE (40 mM Tris-acetate pH 8.0; 0.1 mM EDTA)
and stained with ethidium bromide. 1 µl of digested DIG-labeled fragments was mixed with 9
µl of formamide gel loading buffer II (Ambion; Applied Biosystems GmbH). DNAs,
denatured at 85 °C for 5 min, quenched on ice and immediately loaded onto a 1.5% agarose
gel. After electrophoresis in 1× TBE, the DNA was transferred to a positively charged nylon
membrane (Roche GmbH) with 20× SSC as transfer buffer, and DIG-labeled fragments were
detected with Anti-Digoxigenin-AP Fab fragments (Roche GmbH) according to the
manufacturer’s instructions except that milk powder (Carl Roth GmbH + Co. KG) was added
to the blocking solution (final concentration: 5%).
Characterization of ZFN off-target activity
To characterize ZFN off-target activity in cellula, the ZFNs were transfected as described for
the repair experiments with following changes: Only one of the two ZFNs was used either by
replacing the expression vector of the partner nuclease with the backbone-only version
(pRK5) or by doubling the amount of its expression vector to keep the total amount of input
DNA constant; the repair matrix 3-1corr-BdT was either also transfected or replaced by a
matrix DNA-free calcium precipitate (mock). Genomic DNAs from transfected cells were
digested with AseI (analysis of the regular ZFN target site) or MboII (analysis of the second
ZFN target site), and then used as templates for amplification as described above. The PCR
products were re-digested with the respective endonucleases to enrich for modified locus
alleles, which then were gel-purified, subcloned and sequenced (Fig. S7). Technical problems
in the analyses of the second ZFN target site did not allow efficient reduction of the original
target locus molecules which resulted in unreliable detection of the respective possibly
modified alleles. Since point-mutated alleles might have alternatively been generated by
polymerase errors during the PCR, they were not scored as off-target events.
Supplementary Materials and Methods
Page 11 / 13
Sequence analyses.
For sequence analyses, PCR products were gel-purified (Ultrafree®-DA, Millipore GmbH)
and subcloned with the TOPO® TA Cloning® Kit (Invitrogen GmbH) according to the
manufacturer’s instructions except that XL2-Blue Ultracompetent Cells (Stratagene; Agilent
Technologies Sales & Services GmbH & Co. KG) were used for transformation. Individual
bacterial colonies were picked, plasmid DNAs were prepared (Mini Prep, QIAGEN GmbH),
and inserts were sequenced with primers #48-LacZ-TC or gfp7 (BigDyeTM Terminator v1.1;
ABI Prism 3100 genetic analyzer (Applied Biosystems GmbH)). Since some inserts were not
readable in its entirety mostly due to hard stops, the following chemical modifications were
tried (however, without success): dGTP BigDyeTM Terminator Kit (Applied Biosystems
GmbH); addition of 1 M betaine (Sigma-Aldrich GmbH); replacing the template plasmid
DNA with fragments amplified by PCR in the presence of 7-deaza-dGTP replacing dGTP;
combinations thereof.
To group the sequences into the 6 or 7 predefined categories and calculate their respective
frequencies (Figs. 4, S3), the following general assumptions were made: Any sequence which
deviated after targeted gene repair attempts from the sequence of the original or the faithfully
corrected locus was assumed to be a unique event, and therefore, only the numbers of
different types of sequences were used for calculation rather than counting each sequenced
bacterial clone. However, concerning the original and the faithfully corrected target locus,
each sequenced bacterial clone was counted, because these alleles constituted the majority of
template fragments and were thus likely amplified independently. To arrive at the percentages
for the categories, the numbers of the respective independent sequences were divided by the
number of all independent events of the respective experimental sample.
Supplementary Materials and Methods
Page 12 / 13
Software.
Figures were prepared with CorelDRAW X3 version 13.0.0.576 (Corel Corporation). Gel
pictures taken with an AlphaImager® EP (Alpha Innotech Corporation; Biozym Scientific
GmbH) were processed after import using contrast enhancement and reverse color functions.
Data calculations and diagrams were made using Microsoft® Office Excel 2002 (Microsoft
Deutschland GmbH), and the tool to present the data in box plot format (Fig. 2) was obtained
from the Bildungsserver "learn:line.NRW." (http://www.learnline.nrw.de/angebote/eda/medio/tipps/excel_boxplots.htm#top; maintained by Bruno Pollok
and Peter Weinberg). Intensity measurements of gel bands were carried out with AlphaEase®
FC software version 6.0.0 (Alpha Innotech Corporation; Biozym Scientific GmbH).
FACS analyses were operated and evaluated with BD CELLQuest™ version 3.1f software
(Becton Dickinson GmbH). Cell sortings were operated with BD FACSDiVa™ Software
version 6.1.2 (Becton Dickinson GmbH).
Sequence analyses were carried out using
(i) GCG PACKAGE Version 10.2-UNIX (Wisconsin Package Version 10.2,
Genetics Computer Group (GCG), Madison, Wisc.) installed on solaris
(ii) Lasergene® package version 5.00 (DNAStar Inc.; GATC Biotech)
(iii) UCSC Genome Browser Gateway (http://genome.ucsc.edu/)
UCSC Genome Browser: Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH,
Zahler AM, Haussler D. The human genome browser at UCSC. Genome Res. 2002
Jun;12(6):996-1006.
UCSC Genome Browser database/data:
Karolchik D, Kuhn, RM, Baertsch R, Barber GP, Clawson H, Diekhans M, Giardine B,
Harte RA, Hinrichs AS, Hsu F, Miller W, Pedersen JS, Pohl A, Raney BJ, Rhead B,
Rosenbloom KR, Smith KE, Stanke M, Thakkapallayil A, Trumbower H, Wang T,
Zweig AS, Haussler D, Kent WJ. The UCSC Genome Browser Database: 2008 update.
Nucleic Acids Res. 2008 Jan;36:D773-779.
Genome assemblies:
Homo sapiens: Feb. 2009 (hg19) assembly; human reference sequence (GRCh37)
Bos taurus:
Oct. 2007 (bosTau4) draft assembly (Baylor release Btau_4.0)
Supplementary Materials and Methods
Page 13 / 13
BLAT alignment tool:
Kent WJ. BLAT - the BLAST-like alignment tool.
Genome Res. 2002 Apr;12(4):656-664.
(iv) Ensembl Genome Browser (http://www.ensembl.org/index.html)
Matching ZFN binding sites to human genome:
BLASTN (http://www.ensembl.org/Multi/blastview) with following settings:
Summary:
setup
Homo_sapiens (Ensembl release 54 - May 2009 © WTSI / EBI)
LATESTGP
Custom sensitivity:
-E: 10000; -B: 5000; -filter: none; -RepeatMasker off
-W: 4; -wink: 1; -M: 1; -N: -3; -Q: 3; -R: 3
References:
1.
Alwin, S, Gere, MB, Guhl, E, Effertz, K, Barbas, CF, 3rd, Segal, DJ et al. (2005).
Custom zinc-finger nucleases for use in human cells. Mol Ther 12: 610-617.
2.
Radecke, S, Radecke, F, Peter, I and Schwarz, K (2006). Physical incorporation of a
single-stranded oligodeoxynucleotide during targeted repair of a human chromosomal
locus. J Gene Med 8: 217-228.
3.
Radecke, F, Radecke, S and Schwarz, K (2004). Unmodified oligodeoxynucleotides
require single-strandedness to induce targeted repair of a chromosomal EGFP gene. J
Gene Med 6: 1257-1271.
4.
Radecke, F, Peter, I, Radecke, S, Gellhaus, K, Schwarz, K and Cathomen, T (2006).
Targeted chromosomal gene modification in human cells by single-stranded
oligodeoxynucleotides in the presence of a DNA double-strand break. Mol Ther 14:
798-808.