1
HEP-12-0728.R2
SUPPORTING MATERIAL
Tx-j colony development and maintenance
Since the concentration of Cu in tx-j mouse breast milk is insufficient to maintain neonatal growth and
development, all tx-j pups were fostered to a lactating control C3H dam at day 7 post-partum as
recommended by The Jackson Laboratory. Mice were maintained at 20-23°C, 45-65% relative
humidity, and a light cycle of 14 h light/10 h dark. Mice were fed a standard laboratory mouse chow,
LabDiet 5001 (Purina LabDiet, Richmond, IN), which contains the following: 13 ppm Cu, 270 ppm
Fe, 70 ppm Zn, 28% Kcal protein, 12% Kcal fat, and 60% Kcal carbohydrate. Food and deionized
water were provided ad libitum. At the end of each treatment protocol (PCA and betaine studies), mice
were anesthetized via inhaled isoflurane and approximately 1 ml of blood was collected from the retroorbital sinus into separator tubes and centrifuged to obtain plasma. Livers were removed and sections
from each liver were placed in formalin for subsequent blocking in paraffin, added to perchloric acid
for high performance liquid chromatography (HPLC) analysis, and flash-frozen in liquid nitrogen and
stored at -80°C for further analysis.
All mouse protocols followed the guidelines of the American Association for Accreditation of
Laboratory Animal Care and were reviewed and approved annually by the UC Davis Institutional
Animal Care and Use Committee. All animals received humane care according to the criteria outlined
in the "Guide for the Care and Use of Laboratory Animals" prepared by the National Academy of
Sciences and published by the National Institutes of Health (NIH publication 86-23 revised 1985).
Light microscopy and histology
Liver sections were stained with hematoxylin and eosin for histology and with Masson Trichrome stain
for fibrosis. Slides were scanned using an Aperio Scanscope XT to produce digital whole slide images.
Images were analyzed using Aperio Imagescope, and hepatocyte and nuclei diameters were measured
using the ruler tool with a resolution of 2 pixels per um. Fiji software was implemented to verify
2
reproducibility of diameter measurements. For each slide, an average of 46±2 hepatocytes in 4-6
mice/treatment or genotype were measured. To calculate mean nuclei area in each treatment group,
hepatocyte nuclei were located and their area was measured using the Fiji measure command. The Fiji
software was considered reliable to automatically calculate nuclei area but not cell area due to high
variability in hepatocyte dimensions in tx-j mice. Lobular inflammation was graded by a pathologist on
a four-point scale based on inflammatory foci per 20×: grade 0; 1 with 1–2 foci; 2 with 3–4 foci; 3 with
>4 foci. Portal tract inflammation was graded none, mild, moderate, and severe (0-3) (1, 2).
Hepatic Copper and Iron quantification
Sections of liver (~100 mg) were digested with concentrated nitric acid and wet-ashed. Urinary and
hepatic Cu and hepatic Fe were analyzed by flame atomic absorption spectroscopy (Smith-Heifjie
4000, Thermo Jarrell Ash, Franklin, MA) (3) and were expressed as concentrations per mg/L (urine) or
ug/g dry weight (liver).
HPLC with fluorescence detection of methionine metabolites
200 mg of fresh liver tissue were homogenized in 1 ml of cold 0.4 M perchloric acid and then
centrifuged for 2 min at 8000×g. The supernatant was frozen at -80°C until HPLC analysis of SAH and
SAM. Plasma homocysteine levels were measured by HPLC (4). Methionine metabolite quantification
with HPLC was performed within 4 weeks from the tissue harvesting to ensure sample stability (5).
RNA isolation, cDNA synthesis, and Quantitative Real-Time PCR
Total RNA was isolated from frozen liver specimens using the RNeasy Mini Kit (Qiagen, Valencia,
CA). The concentration and purity of extracted RNA was determined by measuring the absorbency at
A260 and A280. Extracted total RNA was stored at -80°C until use. The extracted total RNA was
subjected to two separate reactions, one to synthesize cDNA and the other to test for DNA
contamination. Reverse transcription was carried out using 2 μg of DNase-treated RNA, following the
protocol provided in the SuperScript III First-Strand cDNA synthesis kit (Invitrogen, Carlsbad, CA).
Primers for mouse cDNA sequences were designed using Primer Express 3.0 (Applied Biosystems,
3
Foster City, CA) or NCBI Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and
blasted against the mouse genome using NCBI blastn to check primer specificity
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). The amplification efficiency (E) of all assays was calculated
from the slope of a standard curve generated in triplicate for every cDNA sample using the formula E
= 10(-1/slope) -1.
Primer sequences used were as follows:
Supporting Table.
Gene
Forward primer 5' to 3'
Reverse Primer 5' to 3'
CPT1A
GGAGGAGACAGACACCATCCA
CGTCATGGTAGAGCCAGACCTT
DNMT1
CCAGCTGCCAAACGGAGA
CCTCGGGAGTCTCTGGAGCTA
DNMT3a
CACTGGAGTAGGCGCTGAGAC
CAGCAAAGGGCCTTCCATAG
DNMT3b
CCGTTCGACTTGGTGATTGG
GGGCAGGATTGACGTTAGAGAG
GRP78
GTGGAGATCATAGCCAACG
CACATACGACGGCGTGATGC
HPRT1
TGGGAGGCCATCACATTGT
ATCCAGCAGGTCAGCAAAGAA
PPAR α
CGATGCTGTCCTCCTTGATGA
GAAGTCAAACTTGGGTTCCATGAT
SAHH
ATCCTTGGCCGGCACTTT
TTCTTTAGCCAGTAGCGGTCCA
SREBP1c
CTGGCTTGGTGATGCTATGTTG
GACCATCAAGGCCCCTCAA
TNF-α
TGGCCTCCCTCTCATCAGTT
GCTACAGGCTTGTCACTCGAATT
In order to obtain accurate and reproducible results, all assays were determined to have an efficiency
of >95%. Each reaction was performed in triplicate using SYBR Green I dye detection on the AB ViiA
7 Real-Time PCR System or the ABI Prism 7900HT Sequence Detection System (Applied Biosystems,
Foster City, CA). Reaction conditions were 50°C for 2 min and 95°C for 10 min, followed by 40
4
cycles of 95°C for 15s and 60°C for 1 min. Cycle threshold (Cq) values were exported with a threshold
of 0.1. Using the qPCR method, the relative expression level of a target gene in a particular sample
was calculated using the equation 2−ΔΔCq, where ΔΔCq = ΔCq(sample) − ΔCq(calibrator). Therefore,
all gene transcriptions were expressed as an n-fold difference relative to the calibrator, which is the
mean value for the control (untreated wild type mice) samples. The method measures the
transcriptional activity of a target gene as the fold change of E and Cq deviation (ΔCq) in tissue
samples from experimental groups minus values obtained from control groups, and is expressed in
comparison to HPRT1 (reference gene) (6). Cq values of target genes of all samples were normalized
to HPRT1 to compensate sample-to-sample and run-to-run variations and to ensure experimental
reliability (7). The stability of the chosen reference gene was assessed between experimental groups by
calculating its coefficient of variation (CV) (ratio between the standard deviation of Cq values and the
average of the Cq values). HPRT1 reference values were analyzed in triplicate with coefficient of
variation = 3.3%, indicating stability of the expression (8).
Protein isolation and Western Blot
About 50 mg of each liver sample was homogenized, total lysates were prepared, and Western blots
were performed as previously described (9). Western blot analyses were carried out using mousespecific antibodies to SAHH (1:400), GRP78 (1:400) (Santa Cruz Biotechnology Inc, Santa Cruz, CA);
SREBP1c (1:200), PPAR α (1:100), CPT1A (1:100) (Abcam, Cambridge, MA), and β-actin (1:5,000)
(Sigma-Aldrich, St. Louis, MO). Horseradish peroxidase (HRP)-conjugated anti-rabbit IgG, anti-goat
IgG (both Pierce, Rockford, IL), and anti-mouse IgG (Jackson ImmunoResearch Laboratories, Inc.,
West Grove, PA) were used as the secondary antibodies. After incubation with primary and secondary
antibodies, blots were developed with the SuperSignal West Dura Extended Duration Substrate
chemiluminescent detection system (Pierce, Rockford, IL). Band intensities were quantified using Fuji
Film Multi Gauge software and standardized against β-actin.
5
Serum Biochemical Measurements
Serum alanine aminotransferase (ALT) and bilirubin were assessed using routine biochemical
laboratory methods.
Analysis of global DNA methylation levels by dot blot analyses
DNA was isolated from each liver sample (Qiagen, Valencia, CA) using about 15 mg of tissue.
Relative methylation dot blots were performed as described in Woods et al. (10). Briefly, 50ng of
genomic DNA was alkaline denatured and spotted in triplicate on a nitrocellulose membrane, followed
by UV cross-linking. Membrane was blocked in LiCor Odyssey Blocking Buffer, then incubated in
Blocking Buffer + 0.1% Tween-20 with Anti-5-Methylcitidine (Eurogentec) overnight at 4°C.
Membrane was washed in 1x PBS-0.2% Tween-20, then incubate in Blocking Buffer + 0.1% Tween20 with LiCor 700-IR secondary antibody. Blot was imaged using a Licor Odyssey Imager. Blot was
then washed in 1x PBS-0.1% Tween-20 followed by equilibration in PerfectHyb Plus Hybridization
Buffer (Sigma) at 42°C. Biotin labeled gDNA was hybridized overnight at 42°C, as a loading control.
Blot was incubated with LiCor Streptavidin 800-IR secondary antibody in Blocking Buffer + 0.1%
Tween-20 for one hour at room temperature. Blot was imaged on LiCor Odyssey Imager, and
integrated intensities were quantitated using LiCor Odyssey software. Methylation signal was
normalized to total DNA signal.
Immunostaining for 5-methylcytosine
Stainings were performed on paraformaldehyde-fixed tissue at an antibody dilution of 1:1,000 for 5methylcytosine (Eurogentec, Fremont, CA). Immunostaining was conducted in accordance with
standard protocols for treating paraffin-embedded specimens, except that samples were immersed in
HCl (3.5 N) for 15 minutes after heating in buffered citric acid. Images were obtained using a Zeiss
Axioskop fluorescent microscope with 20x objective, and recorded at identical settings with a Zeiss
Axiocam. The intensity of nuclear fluorescence was quantified using FITC, Red, and DAPI filters and
Fiji (ImageJ) 1.46j morphometric software (11). The total integrated optical density (IOD) for each cell
6
was found by multiplying the cell’s mean optical density by the area of that cell. The sum of all cell
IOD values divided by the total cell area gave the mean IOD for all cells in an image (Group Mean).
To compare the distribution of stain within each slide, and to account for inconsistent staining we
normalized by dividing the resulting value by the mean intensity of the entire image, yielding Group
Mean Normal. To measure intra-nuclear concentrations, we found the kurtosis of each cell, and then
calculated the percentage of cells with a kurtosis greater than 5.0 (Mean Percent). To compensate for
inconsistent DAPI staining, the green primary antibody channel and the red autofluorescence channel
were used to locate cell nuclei. The resulting regions were consistent with the DAPI stained regions
for the samples with high quality DAPI staining. Quantification was performed on 3 fields per
specimen. An average of 305 ± 35 nuclei were counted per specimen.
Statistical analyses
Statistical analyses were performed using SAS statistical software, version 9.2 (SAS Institute Inc,
Cary, NC). Descriptive statistics were calculated for each measurement by treatment group for each
genotype. Prior to statistical analysis, the distributions of measurements were assessed to determine
whether the distributions were approximately normal. If necessary, the natural log transformation was
applied to the data in order to improve the normality of residuals and homoscedasticity of errors as
appropriate and then the log-transformed values were used in the subsequent analyses. Inter-group
comparisons in mean were performed by analysis of covariance (ANCOVA), adjusted for the baseline
values. For repeated measured variables, we performed repeated measures analysis of variance
(ANOVA) to compare longitudinal trajectories between groups. Individual trajectories for changes
over time in each variable were estimated from linear random-effects models while adjusting for
covariates. To account for between-subject heterogeneity in the change of variable, intercept and time
were modeled as random effects. Multiple comparisons were controlled by the Bonferroni correction
method where appropriate. Pearson correlation coefficient and its p-value for significance of
correlation were calculated to assess the magnitude and direction of an association between two given
7
measures based on their ordered ranks. Statistical significance was determined at a two-sided p-value
<0.05.
Supporting Figure.
Copper
Inflammation
CpG-DNA
SAM
DNMTs
CH3
CpG-DNA
Methionine
DMG
MS
BHMT
Betaine
SAH
SAHH
Copper
Homocysteine
Methionine metabolism and possible interactions with copper accumulation and inflammation.
Main steps in methionine metabolism including bidirectional S-adenosylhomocysteine hydrolase
(SAHH), transmethylation and transsulfuration pathways. SAM: S-adenosylmethionine; SAH: S-
8
adenosylhomocysteine; BHMT: betaine-homocysteine methyltransferase; DMG: dimethylglycine;
MS: methionine synthase; GSH: glutathione; CβS: cystathionine β synthase.
We hypothesize a double effect of copper (Cu) accumulation on methionine metabolism, due to the
effect of inflammation on increased demand for methyl groups and to down-regulation of Sahh by
increased levels of the DNMTs inhibitor SAH.
Supporting references
1. Brunt EM, Janney CG, Di Bisceglie AM, Neuschwander-Tetri BA, Bacon BR. Nonalcoholic
steatohepatitis: a proposal for grading and staging the histological lesions. Am J Gastroenterol
1999;94:2467–2474.
2. Cope-Yokoyama S, Finegold MJ, Sturniolo GC, Kim K, Mescoli C, Rugge M, Medici V. Wilson
disease: histopathological correlations with treatment on follow-up liver biopsies. World J
Gastroenterol 2010;16:1487-94.
3. Clegg MS, Keen CL, Lönnerdal B, Hurley LS. Influence of ashing techniques on the concentration
of trace elements in animal tissues. I: Wet ashing. Biol Trace Elements Res 1981; 3:107-115.
4. Gilfix BM, Blank DW, Rosenblatt DS. Novel reductant for determination of total plasma
homocysteine. Clin Chem 1997;43:687–688.
5. Giulidori P, Stramentinoli G. A radioenzymatic method for S-adenosyl-L-methionine
determination in biological fluids. Anal Biochem 1984;137:217-220.
9
6. Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes,
differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pairwise correlations. Biotechnol Lett 2004;26:509-15.
7. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, et al. The MIQE
guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin
Chem 2009;55:611-22.
8. de Jonge HJ, Fehrmann RS, de Bont ES, Hofstra RM, Gerbens F, Kamps WA, de Vries EG, et al.
Evidence based selection of housekeeping genes. PLoS One 2007;2:e898.
9. Esfandiari F, Medici V, Wong DH, Jose S, Dolatshahi M, Quinlivan E, Dayal S, et al. Epigenetic
regulation of hepatic endoplasmic reticulum stress pathways in the ethanol-fed cystathionine beta
synthase-deficient mouse. Hepatology 2010;51:932-41.
10. Woods R, Vallero RO, Golub M, Suarez JK, Ta TA, Yasui DH, Chi LH, et al. Long-lived
epigenetic interactions between perinatal PBDE exposure and Mecp2308 mutation. Hum Mol
Genet 2012; 21: 2399-411.
11. Walter T, Shattuck DW, Baldock R, Bastin ME, Carpenter AE, Duce S, Ellenberg J, et al.
Visualization of image data from cells to organisms. Nat Methods 2010; 7 (3 Suppl): S26 -S41.