Abbreviations:
HA epitope: HA (Influenza Hemaglutinin) epitop
Anti-HA antibodies: HA-tagged UDP-galactose transporter (UGT1 or UGT2, wild type
protein sequence or protein sequence with introduced patient’s mutation G266V) was
visualized using HRP-conjugated anti-HA antibodies.
GM130: Golgi apparatus marker; GM130 is part of a cis-Golgi matrix and has a role in
maintaining cis-Golgi structure (Nakamura et al 1995).
Calnexin: Endoplasmatic reticulum marker; integral protein and chaperone of the
endoplasmatic reticulum
GLSII: (Griffonia simplicifolia lectin II); lectin specific for terminal N-acetylglucosamine
MALI: (Maackia amurensis lectin I); lectin specific for terminal galactose and alpha 2,3-sialic
acid-galactose
VVL: (Vicia villosa lectin): recognize terminal N-acetylgalactosamine residues
Online Supplementary material
Description of semi-quantitative RT-PCR
CHO-Lec8 cells, stably transfected with pVitro1 plasmid containing UGT1 and UGT2
sequences in wt and G266V versions, respectively (two clones per construct) were grown to
confluence in 6-well plates. Total RNA from each well was isolated using RNeasy Mini Kit,
using cytoplasmic protocol designed for mammalian cell lines, with additional DNase
treatment, as described in manufacturer’s protocol (QIAGEN). 4 µg of high purity RNA was
used as a template for cDNA synthesis using Superscript III reverse transcriptase (Invitrogen)
and Oligo(dT)15 primer. The cDNA was used in semi-quantative PCR, using primers for
amplification of ~410 bp sequence from UGT-pVitro1 construct (forward GenomicF primer
5’-ccattcgcctctttggcttc-3’ and reverse Vitro1-R primer 5’-cgtcatgctccgctacg-3’) and 434 bp
DNA
coding
a
part
of
Slc35A3
transporter
(forward
NGT434F
primer
5’-gcactccaaagaactttcaactg-3’ and reverse NGT434R primer 5’-ctattacaaggatggctccaag-3’),
used as the internal control. PCR was performed using REDTaq Mix (Sigma) for 30 cycles in
standard conditions. The PCR products were analysed in 1.5% agarose gel with ethidium
bromide.
Details of Fig. 3a: MDCK-RCAr cells were stably transfected with modified pVitro1
plasmids, cultured and treated with antibodies as described in materials and methods. UDPgalactose transporter (UGT1 or UGT2, wild type protein sequence or protein sequence with
introduced patient’s mutation G266V) was visualized using anti-HA antibodies (Cy3; green).
Endoplasmic reticulum and Golgi apparatus were stained with antibodies raised against
specific markers (Cy5; red). Cell nuclei were counterstained with Hoechst 33342 dye.
Details of Fig. 3b: Phenotypic correction of N-glycans was determined using GSLII (lectin
specific for terminal N-acetylglucosamine) and MALI (lectin specific for terminal galactose
and alpha 2,3-sialic acid-galactose). Phenotypic correction of O-glycans was determined
using VVL lectin, recognising terminal N-acetylgalactosamine residues.
Supplemental Fig. 1: Electroencephalography: shows mixed theta wave patterns and
hypsarrythmia
Supplemental Fig. 2: SDS-Page after immunodetection of transferrin (0 transferrin with no
oligosaccharide chain, 1 transferrin with one oligosaccharide chain, 2 transferrin with two
oligosaccharide chains)
Supplemental Fig. 3a: Patient: ESI-TOF mass spectrometry of transferrin
Supplemental Fig. 3b: Control: ESI-TOF mass spectrometry of transferrin
Supplemental Fig. 3c: Patient: ESI-MS data 6 months upon galactose supplementation
shows improvement of glycosylation
Supplemental Fig. 4: Mutation analysis-gDNA and cDNA
top: gDNA contains the SLC35A2 mutation (Exon 4 c.797G>T; G/G homozygosity)
bottom: SLC35A2 mutation c.797 G>T in patient's cDNA isolated from fibroblasts shows
wild type (bld-blood; fb-fibroblast; control-wild type). Both alleles are visible in patient-bld
gDNA (top). However, sequence at cDNA level demonstrates that due to skewed xinactivation only the mutant allele (red circle) is expressed in patient's blood cells, while the
normal allele (black circle) is expressed in the fibroblast sample.
Supplemental Figure 5: Galactose treatment of CHO-Lec8 cells:
A: Phenotypic correction of O-glycans was determined using VVL lectin, recognising
terminal N-acetylgalactosamine residues. B: Phenotypic correction of N-glycans after
galactose treatment was determined using GSLII lectin, specific for terminal Nacetylglucosamine. C: The HA-tagged proteins were quantified using an HA-antibody. D:
Coomassie Brilliant Blue (CBB) gel staining was performed as a loading control.
Supplemental Figure 6: RT-PCR of UGT
RT-PCR of UGT stably overexpressed in CHO-Lec8 cells (upper panel). RT-PCR of
endogenous transporter Slc35A3 (NGT) was used as a positive control. Asterix indicate
clones used in lectin staining after galactose supplementation.
Supplemental Materials 1: Used cell types for functional assay of UDP-Galactose
transporter
MDCK cells: Madin - Darby canine kidney cells; MDCK cells exhibit different distribution of
both splice variants (UGT1 and UGT2)
MDCK-RCAr cells: ricin-resistant mutant of the MDCK cell line; is deficient in galactose
linked to macromolecules because of a lower UDP-Gal transport rate into the Golgi apparatus
(Olczak and Guillen 2006)
CHO cells: Chinese hamster ovary cells
CHO-Lec8 cells: Chinese hamster ovary mutants. They are defective in transporting one of
the nucleotide sugars into the Golgi. Lec8 represents a glycosylation mutant (Stanley 1989).
Supplemental Table 1: Primer sequences
Supplemental Table 1: Primer used for sequencing and for expression analysis.
primer name
primer sequence in 5'-3'-direction
genomic
SLC35A2 Ex 1for (13U)
CTGTAGGGATGGTGGGTAGG
SLC35A2 Ex 1rev (13R)
TGCACACACACACACACACA
SLC35A2 Ex 2for (13U)
ATCCTCGCAGTTCTTTTGGA
SLC35A2 Ex 2rev (13R)
ACTCCTACAGCCCACACAGG
SLC35A2 Ex 3for (13U)
ACGGATGGCTGATTCTTTTG
SLC35A2 Ex 3rev (13R)
CACCCCCAATTTTCACAGAC
SLC35A2 Ex 4for (13U)
CAGGGTCAGCCCTCAGTG
SLC35A2 Ex 4rev (13R)
GACTTGGGTCCTGCAGATG
SLC35A2 Ex 5for (13U)
CAAATGTCAGGATATCCAATGC
SLC35A2 Ex 5rev (13R)
AGCTGAGGTGGGTCATGAGA
SLC35A2 Ex 1for1 (13U)
GGATAAGGCGGGTCTAGTGA
SLC35A2 Ex 1rev1 (13R)
TCTCCCCCTTCTTCAGTGAG
cDNA
SLC35A2 part I for (13U)
AGCTTTTAGGAGCGGAGGAG
SLC35A2 part I rev (13R)
TGAGCTGCCTTTGAGGATCT
SLC35A2 part II for (13U)
CTCCGTGCTCATGCTGAAT
SLC35A2 part II rev (13R)
GAGGTGGGTCATGAGAGAGC