Supplementary information
Isolation and identification of fungi
Litter and soil samples were collected in May 2007 at three of the four natural Austrian forest
sites that were investigated using our metaproteomics approach: (i) Achenkirch, (ii)
Klausenleopoldsdorf, and (iii) Schottenwald. Samples were transferred to sterile tubes and
transported into the laboratory for further processing. The litter samples were shaken with
four-fold diluted Ringer solution (MERCK Darmstadt, Germany); 100 µl of the supernatant
were plated on solid media. Two different isolation-media were used: (i) malt extract agar
(MEA: 2% malt extract, 0.1% peptone, 2% glucose, 2 % agar) and (2) Dichlorane Rose
Bengale agar (Merck).
The isolates were purified in two or three steps by transfer to fresh medium; purity
was checked and maintained by repeated light microscopic observation. For the
morphological studies, the fungi were grown in Petri dishes and as slide cultures on 2% malt
extract agar, Czapek Yeast Agar and Czapek agar (Pitt, 2000). Morphological
characterization of strains was based on the identification keys by Domsch et al (2007), Pitt
(2000), and Klich (2002).
For molecular characterization, fungi were grown on MEA. The mycelium was
scraped from the plates with a scalpel and transferred to a 2 ml tube. 500 µl of CTAB lysis
buffer (2% hexadecyltrimethylammonium bromide, 100 mM Tris, pH 8.0 (HCl), 20 mM EDTA,
1.4 M NaCl, 0.2% mercaptoethanol), glass beads (0.5 mm, acid washed) were added, and
the cells were disrupted by ribolysing. The slurry was incubated for 1h at 65°C. After addition
of 500 µl of chloroform, the solution was centrifuged for 5 min at 13,000 rpm and the
supernatant was transferred to a fresh tube. After addition of 500 µl of ice-cold isopropanol,
DNA was precipitated at -20°C for 30 min and subsequently centrifuged for 5 min at 13,000
rpm. The resulting pellet was washed in 70% ethanol, dried at room temperature and
dissolved in 200 µl TE-buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) plus 2.5 µl RNase (20
U/ml, free of Dnase, Boehringer Ingelheim) and incubated for 5 min at 37°C. DNA
concentration was determined by gel electrophoresis in 1% agarose gels (TAE-buffer; 40 mM
tris-acetate, 1 mM EDTA, pH 8.0) and visualization was with ethidium bromide stain (0.5
mg/ml) as well as using a nanodrop system. For sequencing ITS I, 5.8 S and ITS II, PCR
was performed in 50 µl volumes containing 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2,
0.1% gelatin, 100 pmol of each primer, 200 pmol of each deoxynucleotide triphosphate, 2.5
U Taq DNA polymerase and 200 ng of template DNA. The mixture was amplified by 30
PCR-cycles as follows: denaturation at 98°C for 15 sec, annealing at 55°C for 60 sec and
extension at 72°C for 2 min. The PCR products were purified using Quiaquick PCR
purification columns (Quiagen). Primer pairs ITS1 (5`TCCGTAGGTGAACCTGCGG3`) and
ITS4 (5´TCCTCCGCTTATTGATATGC3`) amplifying the ITS I – 5.8S – ITS II region of the
rDNA were used. Sequencing reactions were performed by the dideoxynucleotide method
using the "Thermo sequenase fluorescent labeled primer cycle sequencing kit" (Amersham),
according to the description of the producer. Sequencing assays were run on an automated
DNA Sequencer (Applied Biosystems). Sequence assembly was done using the Seqman
program (DNASTAR Inc.). Identification of strains was carried out based on database
homology search using the BLAST tool at the National Center for Biotechnology Information
(www.ncbi.nlm.nih.gov.BLAST). The taxonomical and phylogenetic affiliation of the isolates
was based on the fungal taxonomy published by James et al (2006).
Validation of fungal community structure by a culture based approach
The phylum Basidiomycota comprises most of the mushrooms and toadstools, as, for
example, the Agaricomycetes and also the so-called jelly fungi Tremellomycetes. These
fungi are characterized by macroscopically visible fruiting bodies; their mycelium however is
buried in the soil. Mushrooms and toadstools are normally not detected by classical isolation
onto agar plates since they do either not grow at all on agar plates or they just form sterile
mycelia that cannot be identified based on morphological characterization. The same holds
true for the cellulose and lignin degrading fungi (white rot and brown rot fungi) that belong to
the Basidiomycota and are present in dead wood and other decomposing plant material. The
Basidiomycota also include some yeast genera: species of Cryptococcus and Rhodotorula
are frequently found in leaf litter and soil and their existence in Austrian forest soils was
documented by Wuczkowski et al (2005). Pucciniomyctes and Ustilagomyctes (the rust and
smut fungi) are typical plant pathogens on crop plants, the spores of which might be present
in the litter/soil material, though presumably with low activity. Using the metaproteomics
approach, Agaricomycetes and Tremellomycetes were the most abundant basidiomycotal
classes. The two classes, Pucciniomycetes and Ustilagomycetes, predicted to show low
activity in soil/litter, were detected in low abundances or were not detected at all
(Supplementary Table 4, Figure 1E).
The Ascomycota comprise the largest number of fungal species described so far and include
macrofungi such as Morchella and Tuber (truffels), as well as the lichenized fungi, the
classical yeasts (Saccharomyces, Candida, Schizosaccharomyces),and most of the socalled imperfect fungi that are in fact anamorphic states (= non sexual, vegetative states) of
their teleomorphic (= sexual, generative) counterparts within the Ascomycetes. Many of
these “mold” fungi are easily grown on agar plates and thus are frequently detected in
classical isolation and cultivation approaches. The most frequently isolated soil genera found
in the three different Austrian natural forests are Penicillum, Chrysosporium, Trichoderma,
Cladosporium, Acremonium, and Cylindrocarpon (Sterflinger & Metzger unpublished data).
Based on numerous other cultivation studies in all climatic zones of the earth, the genera
Aspergillus, Eurotium, Chaetomium, Gibberella, Fusarium, Phoma and many others are also
commonly regarded as important soil fungi (Domsch et al, 2007). Nearly all of these genera
belong to classes that were also found using the metaproteomics approach: among them the
Eurotiomycetes, the Leotiomyctes, the Dothideomycetes and – albeit to a lesser extent – the
Pezizomycetes
(Figure
1E).
Genera,
representing
the
classes
Sordariomycets,
Leotiomyctes, Eurotiomyctes and Dothideomyctes, were highly abundant among the fungal
isolates from KL, AK, and SW; these classes were also found in high abundances in the
metaproteome analysis (Supplementary Table 4, Figure 1E). In good accordance to the
metaproteomics data, many Mucoromycotina belonging to the genera Mucor, Absidia,
Mortierella and Rhizopus, were found by the cultivation-based approach.
References
Domsch KH, Gams W, Anderson TH (2007). Compendium of soil fungi., 2 edn. IHW-Verlag:
Eching. p 672.
James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ et al (2006).
Reconstructing the early evolution of fungi using a six-gene phylogeny. Nature 443: 818-822.
Klich MA (2002). Biogeography of Aspergillus species in soil and litter. Mycologia 94: 21-27.
Pitt JI (2000). A laboratory guide to common Penicillium species. Food Science Australia. p
197.
Wuczkowski M, Metzger E, Sterflinger K, Prillinger H (2005). Diversity of yeasts isolated from
litter and soil of different natural forest sites in Austria. Aust J Agric Res 56: 201-208.
Supplementary Table 4. Comparison of the fungal structure predicted by the
metaproteomics approach and by a morphological and molecular characterization of
fungal isolates from leaf litter from Achenkirch, Klausenleopoldsdorf and
Schottenwald. n.c., not cultivable; n.d, not determined.
Fungal phyla found in the
metaproteome study
Fungal classes found in the
metaproteome study
Basidiomycota
Pucciniomycetes
(very low abundance)
Ustilaginomycetes
(very low abundance)
Tremellomycetes
(very low abundance)
Agaricomycetes
Ascomycota
Found as isolates
Dominant genera
isolated from litter
samples
+
Cryptococcus
n. c. on plates
Sordariomycetes
+
Schizosaccharomycetes
(very low abundance)
Saccharomycetes
(very low abundance)
Pezizomycetes
Lecanoramycetes
Leotiomycetes
Eurotiomycetes
Dothideomycetes
+
+
n. c. on plates
n. c. on plates
+
+
+
Chaetomium
Ophiostoma
common yeasts,
ubiquitous
Alternaria
Chrysosporium
Cladosporium
Epicoccum
Gliocladium
Paecilomyces
Penicillium
Trichoderma
1
Mucoromycotina
Zygomycetes
Absidia
Mucor
Mortierella
(subphylum)
Rhizopus
1 Because an affiliation of these genera to one of the 3 classes is not always clear we present the isolates in a
pool.
+
Supplementary Figure 1. Coomassie stained 1D SDS-PAGE gels from the different
sampling-sites and -times. 25 µl of each sample were subjected to SDS-PAGE.
Metaproteome analyses were performed in duplicate. A Gels of proteins extracted from
replicate one. B Gels of proteins extracted from replicate two.
Supplementary Figure 2. Comparison of average clusters of orthologous group (COG)
categories. The relative abundance was calculated based on the sum of normalized spectral
abundance factors found for each group at the different sampling sites and times. A COG
categories of bacterial proteins. B KOG categories of fungal proteins. Sampling sites are
presented according to increasing mean air-temperature (from left to right).
Supplementary Figure 3. Heat map depicting the results of a simple linear regression (SLR)
analysis. Community structure and functionality based on normalized spectral abundance
factors (NSAFs) and enzyme activity assays are linked to environmental parameters and
leaf-litter quality. If necessary, values were transformed to achieve normal distribution.
Transformed variables are in italic. The mode of transformation is indicated by superscript
letters. a-log10. blog10, c1/(1+sqrt(PO4)), d1+1/log10(Ca). If data transformation changed the
correlation from negative to positive or vice versa, variables are in bold.
Supplementary Figure 4. Principle component analysis biplots of the community structure
obtained by the metaproteomics analysis with leaf litter quality. A Bacterial phyla, B
Proteobacteria, C Fungal phyla, D Fungal classes. Data points are from different sampling
times (February – squares and May – diamonds) and four sampling sites; AK, Achenkirch;
KL, Klausenleopoldsdorf; OR, Ort and SW, Schottenwald. Stars indicate transforamtions of
the variables to meet the assumption of normal distribution, P is log 10 transformed and Ca
is (1/(1+log10(Ca)) transformed. T, mean air-temperature; WC, water content; *indicates
inversion of the vector orientation because of data transformation.