Supplementary material for
“-Catenin is Essential for Ethanol Metabolism and Protection Against Alcoholmediated Liver Injury in Mice” by Liu et al.
Supplementary methods
NAC Treatment
For NAC treatment, mice were given intraperitoneal injection of NAC (500 mg/Kg body
weight) starting at day 3 (first day of ethanol exposure after an initial 2 d period of
control diet) until the end of the experiment.
Evaluation of liver histology
Liver specimens were fixed in 10% formalin and sections stained with hematoxylin and
eosin (H&E) or oil Red O as previously described. (1)
Serum and tissue biochemical assays
Serum biochemical assays were performed using commercially available kits from
Stanbio Laboratory (Boerne, TX) for glucose (Catalog number 1070), ALT (0930) and
AST (0920). Lipid extraction from liver tissue was performed by chloroform/methanol
extraction using a variation of the Folch method as previously described. (1) Serum and
liver total triglyceride and total cholesterol were measured using commercially available
kits (Catalog numbers 2200-430 and 1010-430, respectively, from Stanbio).
For measurement of plasma ethanol level, whole blood was centrifuged to separate
plasma. A portion of the plasma was then removed and precipitated with perchloric
acid/thiourea containing 1 mM 2-propanol, which was included as an internal standard.
Samples were heated to 67ºC and the vapor phase was quantified for ethanol
concentrations using a Varian gas chromatograph CP 3800 following the procedure of
Eriksson et al. (2) Plasma ammonia levels were measured using freshly collected blood
using a kit (Catalog number ENH3-100) purchased from Bioassay Systems (Hayward,
CA), according to the manufacturer’s protocol. ADH and ALDH enzyme activities were
measured in liver tissue as previously described. (3, 4) Malonedialdehyde levels were
measured in liver tissue with a kit (Catalog number 21044) purchased from
OxisResearch (Portland, OR) according to the manufacturer’s protocol.
Analysis of pyridine nucleotides: Spectrum Lab pulverizer (Rancho Dominguez, CA,
USA) cooled in liquid nitrogen was employed to prepare frozen tissue powder. The
pulverized material was transferred into extraction medium containing (0.5 M KOH and
50 mM cysteine. (5) The extract was sonicated in the water bath for 5 min at 21°C using
a horn probe (431C) connected to a Sonicator 3000 (Misonix, Farmingdale, NY) that
was set at power position “0.5” (36 dB). Then the extract was neutralized by 1 M citric
acid and centrifuged at 10,000 x g for 10 min. Sodium ascorbate, 10 mM was added to
the clear supernatant to stabilize reduced pyridine nucleotides. Aliquot of the prepared
tissue extract was incubated with alcohol dehydrogenase in the presence of ethanol
plus hydrazine to convert tissue NAD+ to NADH for subsequent analysis. (6) Analysis of
NAD(P)H was preformed by reverse phase HPLC with Shimadzu LC-100AT vp HPLC
chromatograph equipped with fluorescence detector (model RF-10Axl) and autosampler
(model SIL-10AD vp). Aliquot of tissue extract (10 μl) was injected into a C-18 reverse
phase column (HP Hypersil, 5 μm, 100 x 4.6 mm) protected by guard cartridge and
connected with a fluorescence detector. The column was eluted by mobile phase
composed of 0.2 M KH2PO4 (pH 6.0), and 3% ethanol. The flow rate was 1 ml/min.
Fluorescence of pyridine nucleotides in the eluate was monitored at “Gain 3, sensitivity
2” and at an emission of 460 nm, after excitation at 340 nm. Chromatograms was
processed and stored in digital form with Class-VP software. All separations were
performed at ambient temperature (~23°C).
Mitochondrial complex and enzyme activity assays.
Complex I, II, and IV activity, and citrate synthase and aconitase activity levels were
measured in mitochondria isolated from freshly harvested livers as previously
described. (7)
RNA Isolation and real time PCR (RTPCR)
Total cellular RNA was obtained and quantitative RTPCR performed as previously
described. (1) Proprietary Taqman RTPCR primers were purchased from Applied
Biosystems and inventoried assays recommended by the manufacturer for each gene
were used.
Protein extraction and western blot analysis
Western blot analysis was performed as previously described. (8) Nuclear and
cytoplasmic fractions were separated from freshly harvested liver tissue using a Pierce
NE-PR kit. The following antibodies were used for western blot analysis (manufacturer):
SOD-2 (Abcam), GAPDH (Abcam), FoxO3 (Cell Signaling); -catenin (Millipore); ADH1
A/B/C (GeneTex); ALDH2 (GeneTex); Cyp2E1 (Abcam).
Immunofluorescence microscopy: Frozen liver sections were analyzed by
immunofluorescence for alcohol dehydrogenase with the ADH 1A/1B/1C (GeneTex;
1:200 dilution) antibody as previously described. (9, 10)
Chromatin immunoprecipitation assay (ChIP)
ChIP assays were performed as previously described. (11) The Millipore ChIP assay kit
(catalog no. 17-295) was used as per the manufacturer’s protocol with the following
modifications: Human hepatoma cell lines Hep3B and HepG2 were cross-linked with
formaldehyde and lysed by lysis buffer containing protease inhibitor. The chromatin was
sonicated using a Diagenode Bioruptor (Liege, Belgium) for 15 min, resulting in
reproducible fragments ranging in size from 250–900 bp. The TCF-4 antibody used in
ChIP experiment was from Millipore (Cat#17-10109). The positive control gene SP5
promoter primers as following: left primer 5’ GGGTCTCCAGGCGGCAAG 3’, right
primer 5’ AGCGAAAGCAAATCCTTTGAATCC 3’. Scanning ChIP primers were
designed at approximately 400 bp intervals with product sizes ranging from 150-200 bp.
For the human CYP2E1 promoter, the primers spanned a region from approximately –
4000 bp to the transcription start site. For the human ADH1A promoter, the primers
spanned a region from – 3000 bp to +1000 bp relative to the transcription start site.
Primers sequences are available upon request.
Statistical methods
Results are expressed as mean +/- SEM for each experimental group. Data were
analyzed using one-way analysis of variance, followed by pairwise comparisons with the
Student t test (two-tailed). Values of P < 0.05 were considered significant.
SUPPLEMENTARY REFERENCES:
1.
Behari J, Yeh TH, Krauland L, Otruba W, Cieply B, Hauth B, Apte U, et al. Liver-
specific beta-catenin knockout mice exhibit defective bile acid and cholesterol
homeostasis and increased susceptibility to diet-induced steatohepatitis. Am J Pathol
2010;176:744-753.
2.
Eriksson CJ, Sippel HW, Forsander OA. The determination of acetaldehyde in
biological samples by head-space gas chromatography. Anal Biochem 1977;80:116124.
3.
Bostian KA, Betts GF. Rapid purification and properties of potassium-activated
aldehyde dehydrogenase from Saccharomyces cerevisiae. Biochem J 1978;173:773786.
4.
Kagi JH, Vallee BL. The role of zinc in alcohol dehydrogenase. V. The effect of
metal-binding agents on thestructure of the yeast alcohol dehydrogenase molecule. J
Biol Chem 1960;235:3188-3192.
5.
Sahlin K. NADH and NADPH in human skeletal muscle at rest and during
ischaemia. Clin Physiol 1983;3:477-485.
6.
Ritov VB, Menshikova EV, Kelley DE. High-performance liquid chromatography-
based methods of enzymatic analysis: electron transport chain activity in mitochondria
from human skeletal muscle. Anal Biochem 2004;333:27-38.
7.
Shiva S, Sack MN, Greer JJ, Duranski M, Ringwood LA, Burwell L, Wang X, et
al. Nitrite augments tolerance to ischemia/reperfusion injury via the modulation of
mitochondrial electron transfer. J Exp Med 2007;204:2089-2102.
8.
Monga SP, Pediaditakis P, Mule K, Stolz DB, Michalopoulos GK. Changes in
WNT/beta-catenin pathway during regulated growth in rat liver regeneration. Hepatology
2001;33:1098-1109.
9.
Orlichenko LS, Behari J, Yeh TH, Liu S, Stolz DB, Saluja AK, Singh VP.
Transcriptional regulation of CXC-ELR chemokines KC and MIP-2 in mouse pancreatic
acini. Am J Physiol Gastrointest Liver Physiol 2010;299:G867-876.
10.
Singh VP, McNiven MA. Src-mediated cortactin phosphorylation regulates actin
localization and injurious blebbing in acinar cells. Mol Biol Cell 2008;19:2339-2347.
11.
Zhang P, Metukuri MR, Bindom SM, Prochownik EV, O'Doherty RM, Scott DK. c-
Myc is required for the CHREBP-dependent activation of glucose-responsive genes.
Mol Endocrinol 2010;24:1274-1286.
Supplementary Figures:
Supplementary Figure S1. Laparotomy images showing intraabdominal fat in pair-fed
WT and KO mice.
Supplementary Figure S2. Liver weight on ethanol or control diets.
Supplementary Figure S3. Liver:body weight ratio of WT and KO mice on ethanol or
control diets.
Supplementary Figure S4. Representative HPLC chromatograms showing peaks for
NADPH and NADH from the four treatment groups as indicated.
Supplementary Figure S5. Real time PCR analysis of steady state levels of two
FoxO3a target genes, Cdkn1b and GADD45 from WT and KO livers.
Supplementary Figure S6. NAC treatment fails to protect against ethanol-mediated
liver steatosis. Representative H&E stained liver sections from WT and KO livers from
mice fed ethanol or control diets and treated twice daily with intraperitoneal injection of
NAC (500 mg/Kg).
Supplementary Figure S7. Liver histology from mice fed 5% ethanol for 1 day (after an
initial 6 d ramp-up period). The histology corresponds to the time point when plasma
alcohol and ammonia levels measured in these mice.
Supplementary Figure S8. NAD:NADH ratio in the liver from ethanol or pair-fed WT
and KO mice. (n = 5/group).
Supplementary Figure S9. Real time PCR results for chromatin immunoprecipitation
(ChIP) assay using a TCF4 antibody and Hep3B cells. Primers were designed to
amplify 150-200 bp fragments from segments of DNA spanning approximately 4000 bp
upstream and 1000 bp downstream of ADH1A and CYP2E1 transcription start sites.
SP5 is shown as a positive control for TCF4 binding.