STATE UNIVERSITY COLLEGE AT BUFFALO Department of Biology Biology 100 Principles of Biology Fall 2004 Dr. Wadsworth Mid-Term Exam 3a Chromosomes to Biotechnology Cover Sheet Name: ____________________________________________________ (Print) Instructions. 1. Print your name in the space designated on this cover sheet. 2. Be sure that your exam has 9 pages including this cover sheet. 3. Read each question carefully and answer in the space provide 4. At the end of the exam there are 6 short answer questions. Answer only 5 of these 6 questions. Answering all six questions may reduce your grade. Under the question you choose not to answer, please write the word "Skip". Failure to write "SKIP" under the one question you choose not to answer will reduce your grade. Multiple Choice Choose the best answer for the question or the best ending for each statement. Write the letter (A-E) which corresponds to the best answer on the line before the question. (2 pts each) _____ 1. How many autosomes would you expect to find in a male human skin cell? A. B. C. D. E. 46 44 2 1 none ______ 2. Interphase is part of the cell cycle. Which of the following happens during interphase? A. B. C. D. E. Sister chromatids divide DNA is replicated The number of chromosomes doubles Sister chromosomes synapsis forming tetrads Genetic recombination takes place ______3. The number of chromosomes found in a eukaryotic cell: A. B. C. D. E. doubles during mitosis doubles during meiosis is haploid among asexually reproducing forms and diploid if they reproduce sexually. is doubled by fertilization and cut in half by meiosis. is dependent on the age of the tissue. _____ 4. Chromatin is composed of both DNA and histones. If DNA and histones were disassembled into the monomers that compose them, which of the following monomers would be generated. A. B. C. D. E. Fatty acids and Nucleotides Amino acids and Fatty acids Amino acids and Nucleotides Monosaccharides and Fatty Acids Monosaccharides and Nucleotides _____ 5. The condition neurofibromastosis was made famous by the movie "The Elephant Man." This disease is characterized by tumor like formations on the skin and is a dominant genetic trait. If two people homozygous for the trait have children, what phenotypes will those children exhibit? A. B. C. D. E. All the children will have neurofibromastosis Most of the children will have neurofibromastosis Most of the children will be healthy About ½ of the children will be healthy All the boys will have neurofibromastosis and all of the girls will be healthy _____ 6. Mendel’s study of genetics differed from his contemporaries’ studies because he: A. B. C. D. E. studied traits influenced by the environment. examined several different traits at the same time. studied individual traits worked on plants rather than animals. confirmed the blending theory of inheritance. _____ 7. In dogs, a single gene controls ear floppiness. The allele for erect ears is dominant and the allele for floppy ears is recessive. If I breed a true-bred german shepherd (erect ears) with a true-bred Labrador retriever (floppy ears) what is the probability that the first pup will have erect ears? A. B. C. D. E. 0% 10% 25% 75% 100% _____ 8. A woman is diagnosed to have the genetic disease known as Huntington’s disorder. It is a rare defect caused by an autosomal dominant allele. She is heterozygous for the trait. If she mates with a healthy male, what is the probability that any one of her children to inherit the disease? A. dependent on the sex of the child. B. 1/3. C. 1/2. D. 3/4. E. 100% _____ 9. If a colorblind man marries a women heterozygous for colorblindness, what proportion of their offspring would you expect to be color blind? A. B. C. D. E. 100% 75% 50% All the male children 0% _____ 10. The sex chromosome composition of a person with Klinefelter syndrome is A. XXX. B. XO. C. XXY. D. XYY. E. none of these _____ 11. Which of the following do not make-up part of DNA? A. B. C. D. E. Amino Acids Nucleotides Deoxyribose Phosphate Nitrogenous bases _____ 12. Which of the following statements is NOT true about Fred Griffith’s experiments? A. Mice injected with smooth (S) bacteria die. B. Mice injected with heat-killed smooth bacteria die. C. Mice injected with heat-killed smooth bacteria and live rough (R) bacteria die. D. Mice injected with rough bacteria live. E. Smooth bacteria are transformed into harmless rough bacteria. _____ 13. Which of the following enzymes is most responsible for the replication of DNA? A. B. C. D. E. DNase Replicase DNA Polymerase Transcriptase RNase _____ 14. Cystic Fibrosis illustrates the one gene one polypeptide hypothesis because: A. B. C. D. E. The cystic fibrosis gene causes a pleiotropic disease The cystic fibrosis gene is on the X chromosomes The cystic fibrosis encodes a chloride pump The cystic fibrosis allele is recessive to the healthy allele Carriers (heterozygotes) do not have the disease but can pass it on to offspring. _____ 15. Which of the following is involved in the initiation step of transcription? A. B. C. D. E. Promoter Terminator DNA polymerase Start Codon Wobble _____16 . Where is RNA synthesized in a cell? A. B. C. D. E. Ribosomes endoplasmic reticulum. mitochondria nucleus. in phospholipids membranes _____17. Which of the following is not a difference between RNA and DNA A. B. C. D. RNA is single stranded and DNA is double stranded RNA uses Uracil (U) and DNA uses Thymine (T) RNA is in prokaryotes and DNA is in eukaryotes RNA has ribose and DNA has deoxyribose _____ 18. A tRNA has the sequence GGG as its anticodon. What amino acid would you expect to be attached to this tRNA? A. B. C. D. E. Lys Pro Tyr Phe Gly _____ 19. Which of the following determine the position of an open reading frame in a mRNA? A. B. C. D. E. The 5’ and 3’ ends of the mRNA The promoter and terminator sequences The binding site of the large subunit of the ribosome The start and stop codons The set of tRNA’s used in the translation of a particular gene _____ 20. Which of the following is involved in both translational elongation and translational termination? A. B. C. D. E. Promoter Terminator DNA polymerase Start Codon Ribosome _____21. Which of the following carries amino acids to ribosomes, and is considered the "adaptor" molecule between codons and amino acids? A. B. C. D. E. mRNA tRNA hnRNA rRNA all of these _____ 22. Why was golden rice created? A. To produce rice more cheaply B. To create a visually attractive alternative to white rice C. To make rice more resistance to insect pests D. To promotes the use of monocultures E. To make rice more nutritious _____ 23. Which of the following best describes why the federal government allows tax dollars to be spent on adult stem cell research but not embryonic stem cells? A. B. C. D. E. Embryonic stem cell research requires human cloning which is banned around the world. Embryonic stem cell research requires the destruction of embryos Embryonic stem cells technology is not as developed as adult stem cell technology. Embryonic stem cells are not as pluripotent as adult stem cells Embryonic stem cells have been shown to form cancer tumors when used for therapeutic applications. _____ 24. Which of the following best describes a “Pharm Aminal”? A. B. C. D. E. Transgenic animals that have economic value Transgenic animals used to create cheaper agricultural products Transgenic animals that escape into natural ecosystems Trangenic animals that grow faster than non-trangenic animals Transgenic animals used to produce pharmaceutical products _____ 25. Which of the following explain why American farmers grow so much BT corn? A. B. C. D. E. BT corn grows faster than traditional corn In addition for food, BT corn can be used to produce pharmaceutical products BT corn taste better than traditional corn Cows fed on BT corn grow faster than cows fed traditional corn. Less pesticide needs to be sprayed on BT corn. Short Answer Questions Answer only five of the following six questions in the space below each question. Under the one question you choose not to answer, write the word "SKIP". 26. Pseudohypertorphic muschular dystrophy is a disorder that causes gradual deterioration of the muscles. It is only seen in boys born to apparently normal parents and usually results in premature death in the early teens. Is this disorder caused by a dominant or recessive allele? Explain your reasoning. 27. How did Avery show that the genetic material was not RNA? 28. Explain why a non-sense mutation will usually have a bigger impact on phenotype than a mis-sense mutation. 29. Give three reasons that most European countries have rejected the use of transgenic crops. 30 What is the main value of therapeutic cloning to research and medicine? 31. The sequence of a very short mRNA is written below. How many amino acids will the polypeptide encoded by this mRNA have and what is the sequence of amino acids in the polypeptide? GAGGACCUAGAUGCCUGUACCUGGCUAAUCUGUAGUAGUGG