SUPPLEMENTAL MATERIALS AND METHODS
Mouse Studies. The MMTV-PyMT allele was bred onto the C57BL/6 background for at least
seven generations. Tsc2+/- female mice (C57Bl/6 background) were crossed with MMTV-PyMT
male mice and pups genotyped using primers that distinguish between wild-type (wt) and mutant
Tsc2
alleles
5’
CAAACCCACCTCCTCAAGCTTC3’;
(H162:
H163:
5’
AATGCGGCCTCAACAATCG3’; H164: 5’AGACTGCCTTGGGAAAAGCG3’) and the PyMT
transgene
(Forward:
5’
GGAAGCAAGTACTTCACAAGGG3’;
Reverse:
5’
GGAAAGTCACTAGGAGCAGGG3’). PyMT/Tsc2+/+ and PyMT/Tsc2+/- female mice were
palpated twice weekly beginning at 6 weeks of age to monitor tumor onset, and was continued
for 8 weeks thereafter. Mice were sacrificed when tumors had reached a maximum of 2 cm3 for
isolated tumors or 6 cm3 in total for all tumors. For histological analysis, mammary and lung
tissues were excised and stored in 10% neutral buffered formalin for 48 hours before embedding
in paraffin. Mammary tumors were sectioned at 5 µm and lung tissues sectioned in steps at 50
µm. For treatment studies, mice were injected intra-peritoneal daily with either RAP (8 mg/kg)
or vehicle (5.2% PEG 400 and 5.2% Tween-20) for 14 consecutive days prior to sacrifice.
RNAi and Retroviral Transduction. MicroRNA-based shRNAs (shRNAmir) targeting eIF4E
(sh4E.389 and sh4E.610) or the neutral control Firefly Luciferase (shFLuc.1309) (Premsrirut et
al 2011) cloned in retroviral expression vectors were used in these studies. Virus infections
(performed by spinoculation of 2x105 target cells) were repeated every 12 h for a total of 3
cycles. Infected cells were selected 5 days with either hygromycin (2.5 mg/ml) for DOXinducible vectors or puromycin (3 mg/ml) for MLP-based vectors. For transient knockdown,
MDA-MB-231 cells were transfected with either non-targeting (NT) siRNA or siRNAs targeting
human eIF4E (Dharmacon) using lipofectamine 2000 according to the manufacturer’s
recommendations (Invitrogen). Antibodies used for Western blot analysis were directed against
eIF4E (Santa Cruz #sc9976), VEGF (Santa Cruz #sc507), MMP9 (Santa Cruz #sc6840), Cyclin
D1 (cell signaling#2926), β-actin (Sigma#A5316), and α-tubulin (Sigma #T5268). The relative
intensity of signals from immunoblots were quantitated using ImageJ program.
Primers used for Quantitative RT-PCR. Primers used for qRT-PCR (Fig. 6) were: MMP9f (
5’
TCCAACTCACTCACTGTGGTTGCT3’)
and
MMP9r
(
5’
AGACTGCCAGGAAGACACTTGGTT3’),
5’
TGCCAGCAACATTACCACAGTGTC3’)
5’
TCTTCATCCAGCTCCTTGTTGGGT3’),
VEGFCf
and
(
VEGFCr
Cyclin
(
D1f
(5’CAGGTTCCTGTTCACAATACCTCA3’) and Cyclin D1r (5’AGACCGCCCACCTGCC3’),
and
GAPDHf
(5’GAAGGTCGGTGTGAACGGATTTGGC3’)
and
(5’GATGGGCTTCCCGTTGATGACAAGC3’). Error bars represent the SEM.
GAPDHr
SUPPLEMENTAL FIGURE LEGENDS
Figure S1. Changes in tumor size as a function of time post-onset. n=12 for each genotype. Error
bars denote the standard deviation.
Figure S2. Quantitation of TSC2 and p-S6 levels in primary tumors from mice of the indicated
genotypes. Sections from tumor samples were processed for immunohistochemical staining (see
Fig. 1C) and the intensity of the staining was quantitated using Aperio ImageScope. Values
represent the average of 5 fields from 3 different sections. The relative intensity of staining is
denoted as 0, 1+, or 2+, with 2+ indicating the most intense signal.
Figure S3. Genotyping of normal tissues and tumors from PyMT/Tsc2+/+ and PyMT/Tsc2+/mice. Semi-quantitative PCR was used to genotype the Tsc2 locus in DNA from normal tissue of
PyMT/Tsc2+/- (lane 2) or PyMT/Tsc2+/+ (lanes 3 and 4) mice or from breast tumors obtained
from PyMT/Tsc2+/- mice (lanes 5-9). The position of migration of the mutant and wild-type
alleles are indicated to the right. M denotes molecular weight markers (lane 1).
Figure S4. Quantitation of TSC2 and p-S6 levels present in pulmonary metastasis from mice of
the indicated genotypes treated with vehicle or rapamycin. Sections from lungs were processed
for immunohistochemical staining (see Fig. 2B) and the intensity of the staining was quantitated
using Aperio ImageScope. Values represent the average of 5 fields from 3 different sections. The
relative intensity of staining is denoted as 0, 1+, 2+, or 3+ with 3+ indicating the most intense
signal.
Figure S5.
Representative TUNEL assay and Ki-67 staining of mammary tumors from
PyMT/Tsc2+/+ and PyMT/Tsc2+/- mice treated with rapamycin or vehicle. Quantitation of data
is presented in Figures 2D and 2E. Bar, 50 µm.
Figure S6. A. 35S-Methionine metabolic labelling of TM15 cells pre-treated with the indicated
concentrations of rapamycin, silvestrol, or hippuristanol. Cells were exposed to compounds for
two hours in methionine-free medium after which 35S-methionine (150-220 µCi/ml) was added
for 15 minutes. Cells were washed with cold PBS, and lysed in RIPA buffer (50 mM TrisHCl7.5, 150 mM NaCl, 1 mM DTT, 0.1% SDS, 1% NP-40, 0.5% Sodium Deoxycholate, 0.1
mM Phenylmethylsulfonyl fluoride (PMSF), 1 µg/ml each of leupeptin, pepstatin, and aprotinin).
The amount of trichloroacetic acid-insoluble [35S]-labelled protein was quantitated by liquid
scintillation counting. Incorporation was set relative to vehicle-treated TM15 cells. N=3; error
bars represent the SEM. B. Fraction of viable TM15 cells upon exposure to rapamcin, silvestrol,
or hippuristanol. TM15 cells (2.5 x 104) were cultured in 96-well plates and treated with the
indicated concentrations of rapamycin, silvestrol, and hippuristanol for 24 hours. Cells were
fixed with 50% (w/v) trichloroacetic acid for one hour and stained with 0.4% SRB
(sulforhodamine B in 1% acetic acid) for 10 min, after which excess dye was removed by
repeated washing with 1% (v/v) acetic acid. The dye was solubilised in 10 mM Tris base and
quantitated by absorbance at OD490. N=3; error bars represent the SEM.
Figure S7. A. Immunoblot analysis of MLP/sh4E.610- and shFLuc.1309-infected TM15 cells.
Extracts were prepared for blotting after selection of infected cells with puromycin. The
quantitation for relative eIF4E levels is provided below the blot and is from 3 independent
experiments. B. Representative crystal violet staining of migrating and invading MLP/sh4E.610or shFLuc.1309-infected TM15 cells. C. Quantitation of cell migration (left panel) and matrigel
invasion (right panel) of MLP/sh4E.610- and shFLuc.1309-infected TM15 cells. Data
representing three different experiments with five fields counted per experiment. Bars represent
SEM. *, p=0.007.
Figure S8. Quantitation of eIF4E and GFP levels present in primary tumors and pulmonary
metastasis from allografts derived from TM15 cells expressing the indicated shRNAs. Tissue
sections were processed for immunohistochemical staining (see Fig. 4C) and the intensity of the
staining was quantitated using Aperio ImageScope. Values represent the average of 5 fields from
3 different sections. The relative intensity of staining is denoted as 0, 1+, 2+, or 3+ with 3+
indicating the most intense signal.
REFERENCES
Premsrirut PK, Dow LE, Kim SY, Camiolo M, Malone CD, Miething C et al (2011). A rapid and
scalable system for studying gene function in mice using conditional RNA interference. Cell
145: 145-158.