Supplementary Materials and Methods
Materials. MMDX hydrochloride (PNU-152243, nemorubicin) was a gift from Pfizer,
Inc. (New York, NY). IFA was obtained from the Drug Synthesis and Chemistry Branch
of the National Cancer Institute (Bethesda, MD). 4-OOH-IFA and 4-OOHcyclophosphamide were provided by ASTA Pharma (Bielefeld, Germany). Puromycin
dihydrochloride (Cat# P7255), troleandomycin (TAO) (Cat# T6514) and crystal violet
(Cat# C3886) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoconazole (Cat#
30.152.82) was obtained from Research Diagnostics (Flanders, NJ).
Western blotting and P450 reductase assay. Cells grown in 6-well culture plates were
washed with ice-cold 50 mM potassium phosphate (KPi) buffer, 1 mM EDTA (pH 7.4)
and scraped into 200 µl of the same buffer containing 20% glycerol. Cells were lysed by
sonication with 3-10 short (~10 sec) bursts in 1.5-ml eppendorf tubes on ice using a model
550 Sonic dismembrator (Fisher Scientific, Hampton, NH). Total cellular protein was
electrophoresed through a 10% SDS-polyacrylamide gel and transferred to a nitrocellulose
membrane, which was washed and incubated for 1 hr with 5% nonfat dry milk in TBS-T
(Tris buffered saline-Tween; 10 mM Tris Cl (pH 7.6), 0.9% NaCl, 0.1% Tween 20). The
blot was incubated overnight at 4ºC with rabbit polyclonal anti-CYP3A4 COOH-terminal
peptide antibody (kindly provided by Dr. R. Edwards, Royal Postgraduate Medical
School, London, United Kingdom) diluted 1/3000 in 5% non-fat dry milk in TBS-T. The
blot was washed 3 x 10 min in TBS-T and then incubated for 1 hr at room temperature
with a goat anti-rabbit secondary antibody conjugated with horseradish peroxide (Pierce
Supplementary Materials – Lu et al – Page 1
Biotechnology, Rockford, IL) diluted 1: 20,000 into 5% non-fat dry milk in TBS-T.
Antibody binding was visualized using a SuperSignal West Femto fluorescence kit (Pierce
Biotechnology). Lymphoblast-expressed CYP3A4 microsomes (BD Gentest, Woburn,
MA) were used as a standard to quantify CYP3A4 protein levels. P450 reductase activity
was assayed in 0.3 M KPi buffer (pH 7.8) using 25 g cell lysate protein by monitoring
the NADPH-dependent reduction of cytotchrome C at 550 nm ( = 21 mM-1 cm-1,) at
room temperature.
qPCR analysis - TRIzol Reagent (Invitrogen) was used to isolate total RNA from cells
grown in individual wells of 6-well culture plates. The purified RNA was treated with
RNase-free DNase and reverse transcribed followed by SYBR green-based qPCR analysis
in triplicate 4 µl reactions containing 0.3 µM of each qPCR primer and 1:400 diluted
cDNA (final concentrations) using an ABI 7900HT Sequence Detection System (Applied
Biosystems). qPCR primers were designed using Primer Express software (Applied
Biosystems) (1). Two pairs of forward and reverse primers were used for CYP3A4
amplification: ATGAAAGAAAGTCGCCTCGAA (ON-1091) with
AAGGAAATCCACTCGGTGCTT (ON-1092); and AACTGGCCACTCACCATGAT
(ON-1600) with AGGTGGGTGGTGCCTTATTG (ON-1601). The forward and reverse
primers for adenovirus E3 RNA were TTACAGTGCTCGCTTTGGTCT (ON-1311) and
TAAAGCTGCGTCTGCTTTTGTATTT (ON-1312). qPCR results were analyzed by
comparing the CT number (threshold cycle) of CYP3A4 or E3 RNA after normalization
by subtraction of the 18S RNA CT number obtained for the same cDNA sample (1).
Supplementary Materials – Lu et al – Page 2
Recombinant CYP3A4 adenovirus. Adeno-3A4, a replication-defective adenovirus
encoding CYP3A4 cDNA (Research Genetics, Inc., Carlsbad, CA) and driven by the
cytomegalovirus promoter, was obtained from Metabasis Therapeutics, Inc. (San Diego,
CA). Adeno-3A4 was prepared by cloning CYP3A4 cDNA into the adenoviral shuttle
plasmid pShuttle-CMV (Stratagene, La Jolla, CA), followed by virus generation using the
AdEasy XL Adenoviral System (Stratagene). The CYP3A4 cloning site in the final virus
preparation was verified by DNA sequencing. Adeno-3A4 was propagated in human
kidney 293 cells grown in 100-mm dishes at 37°C in high glucose DMEM (Invitrogen cat.
#12800) containing 10% FBS, as follows. Cells were grown to 90% confluence and then
infected with Adeno-3A4 at a multiplicity of infection (MOI) of 5 viral particles per cell.
Alternatively, 3-5 ml of culture supernatant obtained from Adeno-3A4-infected 293 cells
and frozen at -80°C was used to infect each 100-mm dish of 293 cells. Seventy-two hr
after infection, ~80-90% of the 293 cells became rounded and 10-20% of the cells were
floating. The cells from 50 such Adeno-3A4-infected dishes were collected by
centrifugation and resuspended in a total of 20 ml of buffer A (10 mM Tris.Cl (pH 8.0)
and 1 mM MgCl2). Virus was released from the cells by three freeze-thaw cycles,
alternating between an alcohol-dry ice bath and a 37 °C water bath. The cell lysate was
centrifuged at 4°C for 10 min at 3,000 rpm and the supernatant was then treated for 30
min at room temperature with 1 unit/ml of fresh Benzonase (BD Clontech, Mountain
View, CA). The treated supernatant was purified by a two-step CsCl gradient
ultracentifugation protocol (2). The purified virus was dialyzed against buffer A
containing 4% sucrose, with the effectiveness of desalting verified by conductivity
measurement. Viral titers were determined using Adeno-X rapid titer kit (BD Clontech).
Supplementary Materials – Lu et al – Page 3
Adeno-gal, which codes for -galactosidase, and Onyx-017, a tumor cell-replicating
oncolytic adenovirus, were described previously (2).
Adeno-3A4-mediated RNA transcription, protein expression and enzyme activity.
Human lung tumor A549 cells and human brain tumor U251 cells were seeded in 6-well
plates at 300,000 cells per well in RPMI 1640 medium containing 5% FBS. Twenty four
hr later the cells were incubated for 4 hr with Adeno-3A4 in 0.5 ml of RPMI 1640
medium containing 5% FBS to give MOIs specified in each experiment. Two ml of fresh
RPMI 1640 containing 5% FBS was then added to each well and the cells were incubated
for an additional 48 hr. The cells were treated with 2 mM IFA in 2 ml fresh culture
medium together with 5 mM semicarbazide to trap and stabilize the 4-OH-IFA metabolite.
After 4 hr IFA treatment, an aliquot of culture medium (0.5 ml) was removed from each
well and stored at -80°C until ready for 4-OH-IFA analysis. The cells were washed once
with PBS, scraped from the wells in 50 mM KPi buffer (pH 7.8) containing 20% glycerol
and sonicated followed by protein quantification and Western blotting analysis for
CYP3A4 protein. In parallel samples used for RNA analysis by qPCR, RNA was
extracted from A549 and U251 cells infected with Adeno-3A4 in 6-well plates, as
described above, 48 hr after adenovirus infection. In some experiments, A549 and U251
cells were co-infected with Adeno-3A4 (MOI 8) and Onyx-017 (MOIs 0, 0.7, 2, 3, 4)
using the protocol described above, followed by analysis of CYP3A4 RNA, protein and
cellular enzyme activity (metabolism of IFA to 4-OH-IFA).
Supplementary Materials – Lu et al – Page 4
Supplementary Figures
Fig. S1 – Adenovirus-induced CYP3A4 expression in human tumor cell lines A549
and U251. A) Relative CYP3A4 RNA levels determined for A549 and U251 cells
(300,000 cells/well in 6-well plates) infected with Adeno-3A4 at MOI 0, 75, 150 or 300
followed by total cellular RNA isolation and qPCR analysis two days later. CYP3A4
RNA levels are expressed relative to uninfected control cells. In parallel cells infected for
48 hr with Adeno-3A4, as in panel A, cell extracts were assayed by Western blotting for
CYP3A4 protein (c.f., Fig. 4, below) using lymphoblast-expressed CYP3A4 as a standard
(panel B), or were treated for 4 hr with 2 mM IFA in 2 ml fresh culture medium and
assayed for 4-OH-IFA production normalized to total cellular protein recovered after
sonication and lysis in 50 mM KPi buffer, pH 7.4 (C). Data shown are mean + range
values (n=2).
Fig. S2 – Western blot analysis of CYP3A4 protein in Adeno-3A4-infected A549 (A)
and U251 (B) cells. Cells as in Fig. S1 were infected by Adeno-3A4 alone (MOI 0, 75,
150, 300) or Adeno-3A4 (MOI 75) in combination with Onyx-017 (MOI 1 to 10). Two
days later the cells were scraped into 50 mM KPi buffer (pH 7.6) and lysed by sonication.
Cell lysates (40 µg/well) were analyzed on Western blots probed for CYP3A4. Arrow at
right indicates mobility of CYP3A4 protein standard (lanes 1 and 2 of each panel).
Asterisk (*) indicates unidentified CYP3A4 cross-reactive protein that is prominent in
samples co-infected with Adeno-3A4 and Onyx-017. The CYP3A4 immunoreactivity of
Supplementary Materials – Lu et al – Page 5
this Onyx-017 co-infection-dependent band was verified using a polyclonal anti-rat
CYP3A antibody.
Fig. S3 – Effect of Onyx-017 on CYP3A4 RNA and activity in Adeno-3A4-infected
cells. A549 cells and U251 cells (100,000 cells/well in 6-well plates) were infected for 24
h with Adeno-3A4 (MOI 8) alone or in combination with Onyx-017 (MOI 0 to 4). Cells
were incubated for another 24 h, and total RNA or protein were then extracted and
assayed by qPCR for CYP3A4 RNA (A) or E3 RNA (B). RNA values are graphed
relative to the 8 MOI Adeno-3A4 + 0 MOI Onyx-017 samples. In panel C, adenovirusinfected cells as in (A) and (B) were treated for 4 hr with 2 mM IFA in 2 ml fresh culture
medium, and 4-OH-IFA production over a 4-hr incubation period was then assayed.
9L/3A4 cells served as a positive control, and 0 in panel C indicates no virus infection.
Data shown are mean + SD values (n = 3).
Supplementary Materials – Lu et al – Page 6
Supplementary References
1.
Wiwi CA, Gupte M, Waxman DJ. Sexually dimorphic P450 gene expression in
liver-specific hepatocyte nuclear factor 4alpha-deficient mice. Mol Endocrinol
2004;18:1975-87.
2.
Jounaidi Y, Waxman DJ. Use of replication-conditional adenovirus as a helper
system to enhance delivery of P450 prodrug-activation genes for cancer therapy. Cancer
Res 2004;64:292-303.
Supplementary Materials – Lu et al – Page 7