Case Study: Sickle Cell Anemia
Scenario:
A patient and his wife come in to see you with a concern. The patient has a history of sickle cell
disease in his family, but neither of his parents have shown symptoms. The wife is an immigrant from
rural tropical Africa and has no idea if her family has any history of sickle cell disease. However her
mother died during childbirth with her, which is a known complication for individuals with sickle cell
anemia. The couple have 2 children, ages 4, 8 and would like to have another. Their kids don’t know
about the history of the disease. The couple has come to you for advice on whether or not to have
another child, and what to tell their children about the family medical history
Background:
Sickle cell refers to the shape of a red blood cell, which results due to a mutation for amino acid 6 of
the beta hemoglobin protein. This protein is part of the protein complex that carries O2 throughout the
blood. The mutation causes the red blood cell to change shape from round to sickle shape. This
condition is found in all ethnicities, but is highest in people of African descent who originated from
tropical areas where the disease malaria is common. This mutation provides a resistance to malaria,
which helps a person fight the disease and keeps the gene in the human population. The mutation at
the DNA level is a single nucleotide change, which results in the loss of a restriction enzyme (protein
molecule that cuts DNA in a specific place) cut site. The test for the sickle cell allele relies on this
restriction enzyme that will cut the DNA into two pieces (medium and small) when the normal
hemoglobin allele is present. The sickle cell mutation does not allow the restriction enzyme to cut the
DNA. The gene remains in one big piece. DNA of different sizes can be separated by a technique
called DNA Gel Electrophoresis. DNA is a negatively charged molecule and is attracted to a positive
electrical pole. The DNA is placed in a gel (similar to Jello). The gel acts like a strainer with the
smaller pieces of DNA traveling faster and the larger DNA pieces moving slower. The result is that
larger pieces of DNA are closer to where DNA was placed in the gel and smaller pieces are further
away. The pieces of DNA that are the same size will clump together in “bands” of DNA.
Restriction Enzymes and DNA Gel Electrophoresis :
Restriction enzymes and DNA gel electrophoresis can be used to determine the presence of a mutation
in a specific genetic disease. Families with a history of a genetic disease may use DNA testing to
identify individuals who have or carry the disease. There are many different ways of looking at
differences in specific genes for mutations, we can look for a difference in the size of a specific region
of DNA, we can compare sequences by obtaining the sequence of a specific region of DNA and
comparing it to a known, normal gene or mutant. Some mutations either introduce or eliminate a
restriction enzyme recognition site. This allows us to cut that specific piece of DNA and compare
pieces that have or do not have the restriction site. Each restriction enzyme recognizes a particular
short sequence and then cuts it. This can cut the DNA into different sized fragments, which can be
separated using gel electrophoresis. Differences in fragment pattern have been termed DNA
fingerprinting.

Analyze two DNA sequences, and look for a specific recognition sequence for an enzyme to
cut. The two strands of DNA will represent someone from a healthy individual (Strand 1) and
DNA from an individual with the genetic mutation, such as sickle cell anemia.

You pencil will represent the restriction enzyme, Bogus I. Bogus I will cut at the sequence:
AA TT
^
The enzyme recognizes the sequence AATT and cuts in the middle between the A and the T.

Determine the sizes of the DNA fragments after addition of the restriction enzyme, and decided
where the fragments would separate to on the paper DNA Gel Electrophoresis. Start with
Strand 1. Count the number of bases in each fragment and color in a cell that matches the
number of bases in that piece. Repeat for Strand 2. Now you have the DNA pattern for two
alleles of the gene that causes sickle cell anemia. This DNA could be from two individuals.
Remember that most organisms have 2 sets of each gene. Most of the time they are both the same, this
is called homozygous. If the two versions of the gene are different, then the person is heterozygous for
that gene. For two allele possibilities a person can be homozygous for either allele. For example, the
gene that causes sickle cell anemia has a normal function, it is part of the protein complex that carries
O2 throughout the blood. A person can have 2 normal copies (homozygous), 2 mutated copies
(homozygous and with the disease sickle cell anemia) or one of each allele (heterozygous and a carrier
of sickle cell anemia, but without the disease). The normal gene has a restriction site with in the gene
that is eliminated in the mutated sickle cell anemia allele. Based on what you learned with this paper
activity, how many DNA fragments would you expect for a person with one of each of the three
possibilities: homozygous normal, heterozygous, and homozygous mutant alleles. If Strand 1 and
Strand 2 were the alleles for the normal and mutant alleles corresponding to the gene that causes sickle
cell anemia, color in the cells representing the DNA fragment sizes after cutting with Bogus 1 for the
normal homozygous, heterozygous and sickle cell anemia homozygous.
Strand 1
GGTATTTCAATTGAATAACGGAATCCATG
Strand 2
GGTATTTCGATTGAATAACGGAATCCATG
DNA
Size
Strand
#1
Strand Normal
#2
Homozygous
Mutant
Homozygous
Heterozygous
Diagnosis:
1. You have decided to run a DNA analysis on 4 people’s hemoglobin B gene: the patient, his
wife, and the two children.
a. Run the gel.
b. Analyze the results.
2. Decide what you should advise the patient and his wife – should they or should they not inform
the kids about the results of the tests?
Analysis:
1. Write down what sample is in each well
2. Use the provided transparency to mark where the bands are on the gel, record the measurements
on the diagram above.
3. Analyze the gel:
How many bands does the “normal gene ” have? ______
How many bands does the “sickle cell gene” have? ______
[
How many bands for patient? _______
Genotype of patient _______
How many bands for patient’s wife? _______ Genotype of wife _______
How many bands for Child 1? _______ Genotype of Child 1 _______
How many bands for Child 2? _______ Genotype of Child 2 _______
4. Draw a Punnett square to figure out the possible genotypes of the children.
5. Should the patient and his wife tell the kids about the medical history? Why or why not? Would
you recommend for the couple to have another child?