Immunophenotyping
All patients in the study fit the standard definition of BCP-ALL1,2. We designed a prospective
8-color swALL combination (CD45/CD14/CD10/CD20/CD19/CD34/CD33/CD3-8CSAC) to
assess the incidence of immunophenotypic changes between B-lymphoid and monocytic
lineages during treatment. This combination was analyzed in all Czech BCP-ALL patients
with available material at Dx and days 8, 15 and 33 between September 2007 and May 2010
(n=179). FC data were analyzed using Flowjo software (TreeStar, Ashland, OR, USA). CD3
(Exbio, Prague, Czech Republic, clone MEM57) was investigated as an antigen that was
expected to be negative on both populations. Other clones and fluorochromes were as follows:
CD45-FITC (Immunotech, Marseille, France, clone KC56), CD14-PE (Immunotech, clone
116), CD34-PercP-Cy5.5 (BD, San Jose, CA, clone 8G12), CD10-ECD (Immunotech, clone
ALB1), CD20-PB (Exbio, clone LT20 or Biolegend, San Diego, CA, USA, clone 2H7),
CD19-PC7 (Immunotech, clone J3-119) and CD33-APC (Immunotech, clone D3HL60.251).
CD2 molecule was analyzed using antibody (Immunotech, clone 39C1.5) in all patients with
available material at Dx (n=704 patients). Data were acquired on BD FACS LSR II (BD
Bioscience, San Jose, CA, USA) instrument custom equipped with four lasers: standard blue
(488 nm, 20 mW), custom diode red (637 nm, 140 mW) OBIS, Coherent, Santa Clara, CA,
USA and custom diode violet (405 nm, 120 mW) Omicron-Laserage Laserprodukte GmbH,
Rodgau, Germany or on Cyan ADP Flow Cytometer (Dako, Glostrup, Dennmark) equipped
with three lasers: violet (405 nm, 100 mW), red (642 nm, 60 mW) and custom blue laser (488
nm, 20 mW) OBIS, Coherent, Santa Clara, CA, USA
CD2pos Austrian patients were analyzed using a mAb combination including CD19, CD10,
CD34 and CD14 at days 15 and 33. Clone S5.2 (BD, San Jose, CA, USA) was used for
evaluation of CD2 expression in the Austrian and Swiss patients.
Cytogenetics and fusion genes determination
Cytogenetic and FISH analyses were performed prior to therapy according to standard
protocols. BM cells were cultivated for 24h in RPMI 1640 medium with 10% fetal calf serum
without mitogenic stimulation. Chromosomal preparations were made according to
conventional techniques using colcemide, hypotonic treatment, fixation in methanol/acetic
acid and Wright stain (G-banding). The karyotypes were characterized according to the
International System of Human Cytogenetic Nomenclature. All patients were screened for
recurrent, non-random genetic aberrations specific for ALL, including MLL rearrangements,
ETV6/RUNX1 fusion gene and hyperdiploidy, using interphase fluorescence in-situ
hybridization (I-FISH) with locus specific and/or centromeric Vysis probes (Abbott
Molecular). In two patients, FISH was also used to confirm deletion of 9p21 (CDKN2A gene)
found by G-banding.
The presence of TEL/AML1, BCR/ABL and E2A/PBX1 was examined as a part of routine
ALL diagnostics. The presence of the MLL/AF4, MLL/AF6, MLL/AF9, MLL/AF10,
MLL/ENL, MLL/ELL gene fusions was evaluated using multiplex RT-PCR 3.
Single nucleotide polymorphism (SNP) Array
Mononuclear cells from diagnostic and remission BM samples were isolated by Ficoll-Paque
(density 1.077 g/mL; Pharmacia, Uppsala, Sweden) density centrifugation. Aliquoted cells
were stored at –80C prior to DNA extraction. Genomic DNA was isolated by either the
QIAamp® DNA Blood Mini Kit(Qiagen GmbH, Hilden, Germany) or the EZ1 DNA Blood
Kit using a BioRobot® EZ1(Qiagen GmbH, Hilden, Germany).
Genotyping was performed using either the Affymetrix platform as previously described4 or
the Illumina HumanOmniExpress BeadChip according to the Infinium HD assay Ultra
protocol (Illumina Inc., San Diego, CA, USA). The Illumina chips were scanned using an
Illumina iScan instrument and Illumina GenomeStudio software was used for genotype
analysis. CNV analysis was performed using the cnvPartition 2.4.4 software tool within
GenomeStudio. All diagnostic samples were compared to remission samples derived from the
same individual (i.e., matched control). Leukemia-specific CNAs were identified as CNVs
present only in diagnostic samples. All CNAs were further visually inspected in
GenomeStudio Chromosome Browser. Call rates of individual samples ranged from 0.982 to
0.998.
Detection of Ikaros (IKZF1) alterations and ERG deletions
In order to characterize the extent of IKZF1 gene deletions, we performed MLPA® (multiplex
ligation-dependent probe amplification) with probes covering exons 1-8 according to the
manufacturer’s instructions of SALSA MLPA P335 kit (MRC Holland, Amsterdam,
Netherlands). The results were evaluated using the Coffalyser v9.4 software. The gene
expression of various IKZF1 isoforms was evaluated by RT-PCR as published previously5.
Cloning, sequencing
The PCR products were sequenced directly or after cloning to sequencing plasmid vector
when mixed sequence was obtained from direct PCR product. Cloning was performed using a
TOPO TA Cloning Kit for Sequencing (Invitrogen Corporation, Carlsbad, CA) according to
the manufacturer’s instructions. Recombinant bacterial colonies were expanded in liquid
cultivation medium and plasmids were isolated using QIAprep Spin Miniprep Kit (Qiagen
GmbH, Hilden, Germany) according to manufacturer’s instruction. Sequencing of PCR
products and recombinant plasmids was performed on an ABI PRISM 3100 Avant Genetic
Analyzer. Sequences were analysed using BioEdit sotware (Ibis Biosciences, An Abbott
company, Carlsbad, CA).
Multiplex PCR for ERG deletions detection
The multiplex PCR to detect intragenic ERG deletion was performed using 1 forward and 3
reverse primers (forward: 5’-AGGAGAGAAAGGAACCACTGCTTTG-3’, reverse 1: 5’CCCTATGTTGAAATCTTAACCCGCAG -3’, reverse 2: 5’CATCTCAGATGTCTTGCTAGGGGACTC-3’, reverse 3: 5’GTCTAACTCAGAAGCATCTCACGGTAAGG-3’). PCR reaction was based on HotStarTaq
Master Mix Kit (Qiagen GmbH, Hilden, Germany), 25ml reaction volume contained 0.4
mmol/l of each primer, 200ng genomic DNA and was supplemented with 1.5µl of 25mM
MgCl2. Cycling conditions were 15 minutes at 95°C for initial denaturation followed by 50
cycles of 95°C for 20s, 62°C for 20s and 72°C for 40s, terminated with 10 minutes elongation
at 72°C. PCR products were analyzed on agarose gel.
Gene expression analysis
CEBPα gene expression was evaluated by quantitative RT-PCR with 2x QuantiTect® SYBR
Green RT-PCR Master Mix (Qiagen GmbH, Hilden, Germany) using the following primers:
CEBPα forward: ggAgCTgAgATCCCgACA, CEBPα reverse: TTCTAAggACAggCgTggAg
on ABI PRISM® 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA,
USA). Physiological cell populations were sorted from PB control samples with no signs of
MRD using the following immunophenotype characteristics: monocytes (CD14pos),
granulocytes (CD45dimSide-scatterhigh), B (CD19pos) and T lymphocytes (CD3pos).
CSF2RA and CSF1R gene expression were evaluated by TaqMan® Gene Expression Assays
on ABI PRISM® 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA,
USA). Thermal cycling conditions were 2 minutes at 50°C, 10 minutes at 95°C followed by
50 cycles of 95°C for 15s, 60°C for 60s and 15°C till infinity .
RNA extraction, cDNA synthesis and preamplification
RNA from sorted cells was extracted using Qiagen RNeasy Mikro Kit (Qiagen GmbH,
Hilden,Germany) according to the manufacturer’s instructions. DNase treated RNA was
submitted to reverse transcription using iScript cDNA Synthesis Kit (BioRad, Hercules,
CA,USA). First strand cDNA was then preamplified using TaqMan® PreAmp Master Mix
(Applied Biosystems, Foster City, CA, USA) following the manufacturer’s directions, diluted
in sterile water and stored at -20°C till use.
Methylation of CEBPA promoter region
Demethylated CpG dinucleotides were converted by bisulfite treatment to uracil-phosphateguanosine, while methylated CpG dinucleotides remained unchanged. DNA was treated by
EZ DNA Methylation-Gold™ Kit (Zymo Research Corporation, Irvine, CA, USA) and
amplified using CEBPA promoter specific primers : forward 5´-GAA TTA TAG GGG TAG
TTT GGA GAT TA-3´ ,reverse 5´-CCC TCC TCC TAC CTA CCC TAA A-3´. The PCR
products were cloned into a pCR®2.1 vector using TOPO® TA Cloning® Kit (Invitrogen
Corporation, Carlsbad, CA). Plasmids were isolated by QIAprep Spin Miniprep Kit (Qiagen
GmbH, Hilden, Germany) and sequenced. CpG sites were identified as methylated CpG or
demethylated TpG.
Xenotransplantation model
Engraftment was analyzed by flow cytometry every 2 -48 weeks using following monoclonal
antibodies: anti-human CD45 KO (Immunotech, Marseille, France, clone J.33), antimouseCD45 eFlour 450 (eBioscience San Diego, CA,USA, clone 30-F11) and anti-human
CD19 PE (Biolegend, San Diego, CA, USA, clone HIB19) every 2 -48 weeks.
1.
Mejstrikova E, Volejnikova J, Fronkova E, et al. Prognosis of children with mixed
phenotype acute leukemia treated on the basis of consistent immunophenotypic criteria.
Haematologica. 2010;95:928-935.
2.
Mejstrikova E, Kalina T, Trka J, Stary J, Hrusak O. Correlation of CD33 with poorer
prognosis in childhood ALL implicates a potential of anti-CD33 frontline therapy. Leukemia.
2005;19:1092-1094.
3.
Andersson A, Hoglund M, Johansson B, et al. Paired multiplex reverse-transcriptase
polymerase chain reaction (PMRT-PCR) analysis as a rapid and accurate diagnostic tool for
the detection of MLL fusion genes in hematologic malignancies. Leukemia. 2001;15:12931300.
4.
van Delft FW, Horsley S, Colman S, et al. Clonal origins of relapse in ETV6-RUNX1
acute lymphoblastic leukemia. Blood. 2011;117:6247-6254.
5.
Volejnikova J, Mejstrikova E, Dorge P, et al. Ikaros (IKZF1) alterations and minimal
residual disease at day 15 assessed by flow cytometry predict prognosis of childhood
BCR/ABL-negative acute lymphoblastic leukemia. Pediatr Blood Cancer. 2013;60:420-427.