Oral antibiotic treatment induces skin microbiota dysbiosis and influences wound
healing
Meiling Zhang 1, Ziwei Jiang1, Dongqing Li1, Deming Jiang1, Yelin Wu1, Hongyan
Ren2, Hua Peng2, Yuping Lai1*
1. Shanghai Key Laboratory of Regulatory Biology, School of Life Sciences, East
China Normal University, Shanghai, People’s Republic of China , 200241
2. Shanghai Majorbio Bio-pharm Technology C.Ltd., Shanghai, People’s Republic of
China, 201203.
Correspondence: Yuping Lai
MinhangDongchuan Road No.500, Shanghai, 200241, China.
Email: yplai@bio.ecnu.edu.cn
Tel/Fax: 86-21-54342908.
Materials and methods
Animal treatment and sample collection
Wild-type C57BL/6J mice (male, 8-10 weeks) were purchased from the National
Rodent Laboratory Animal Resources, Shanghai Branch of China and were housed in
the animal facility at East China Normal University. The ECNU Animal Care and Use
Committee approved the protocol.
To test the influence of a combination of antibiotics, mice were randomly divided into
two groups (four mice in each group). One group of mice was given drinking water
and the other group was provided with three antibiotics (Vancomycin 1mg/ml,
Clindamycin 1.5mg/ml, Polymycin B 1000U/ml) for seven days. At day 6, dorsal skin
was shaved after the mice were anesthetized with sodium pentobarbital. The
following day, an 8-mm full-thickness excisional wound was made using a biopsy
punch and wounds were monitored for another 5 days. At day 12, the mice were
euthanized. 2mm of each scar, of the same size and the unwounded skin far away
from the scars were collected.
PCR amplification and DGGE profiling
Skin bacteria were characterized by amplifying theV3 region of the 16S rRNA gene.
For amplification, the 25 μL reaction mixture contained 2.5 μL of PCR buffer, 2 μL of
25 mM dNTP mixture, 0.625 U of Ex Taq DNA polymerase and 12.5 pmol of each
primer: P2 (5'-ATTACCGCGGCTGCTGG-3') and P3
(5'-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGG
GAGGCAGCAG-3') as described by Muyzer et al. [1]. The samples were amplified
in a thermocycler PCR system by a touchdown PCR protocol: denaturation for 5 min
at 94C to denature, annealing for 1 min at 65C. The annealing temperature was
decreased by 1C every second during subsequent cycles until touchdown at 55C.
Five additional cycles were conducted at 55C. A final extension was conducted at
72C for 3 minutes [1].
Samples from the different groups were loaded onto a denaturing gradient gel
electrophoresis (DGGE) gel. DGGE was performed with a Dcode System apparatus
(Bio-Rad, Hercules, CA, USA), according to manufacturer’s instructions.
Amplification products were separated on 8% (wt/vol) polyacrylamide gels with a
linear 35 to 55% denaturing gradient (100% denaturant corresponds to 7 M urea and
40% deionized formamide). Electrophoresis was performed in Tris-acetate-EDTA
(TAE) buffer at a constant voltage of 200 V and a temperature of 60C for200 min.
The DNA bands were stained with SYBR green I (Amresco, OH, USA) and
photographed using a UVI gel documentation system (UVItec, Cambridge, United
Kingdom).
Real-time quantitative reverse transcription PCR (qRT-PCR)
The Trizol Reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA
from wounded and unwounded skin samples. The PrimeScriptTM RT regent Kit
(Takara, Dalian, China) was used to synthesize cDNA from 1 μg of total RNA,
according to the manufacturer’s instructions. Real-time RT-PCR was conducted in a
Stratagene MX 3005P (Agilent Technologies, CA, USA). Invitrogen LTD synthesized
the primers (Table 1). The comparative ΔΔCT method was used to quantify the gene
expression in each sample. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
was used as the expression control. All the assays were performed in triplicate and
repeated at least twice.
Table S1．Primers used for gene quantification in this study
Primer
Orientation Sequence (5'-3')
GAPDH
Forward
CTTAGCCCCCCTGGCCAAG
Reverse
TGGTCATGAGCCCTTCCACA
Forward
TTCCTGTCCTCCATGATCAAAA
Reverse
CATCCACCTCTGTTGGGTTCA
Forward
GCTCCAGAAGGCCCTCAGA
Reverse
CTTTCCCTCCGCATTGACA
Forward
TTCTCATTGCCCTGTGG
Reverse
GGCTGCTGGAAGTTGGA
Forward
TGTTTGAGAAAGGAGGCAGAT
Reverse
GGAACTTCCACAACTGCCAATC
Forward
GGCTTCAGTCATGAGGATCCAT
Reverse
TTTGGGTAAAGGCTGCAAGTG
RegIIIγ
IL-17A
IL-22
mBD3
mBD4
Fig. S1 Impaired wound healing and decreased expression of RegIIIγ mRNA after
antibiotic treatment. (a) Photographs of skin wounds after wounding by the biopsy
punch at day 12 (The schematic diagram of the experiment is shown in Fig.1a).
Antibiotics included polymycin B 1000U/ml, vancomycin 1mg/ml, clindamycin
1.5mg/ml (PVC). Four mice were involved in each group. The area of scar was
measured. (b) Quantification of RegIIIγ mRNA expression in unwounded and
wounded skin in mice treated with or without antibiotics. n=4. PVC indicates the
combination of these three antibiotics
Fig. S2
Vancomycin treatment influences the intestinal bacterial structure and
decreases the expression of RegIIIγ and IL-17. (a) DGGE pattern of the intestinal
bacteria. C, control group; V, vancomycin treated group. (b) Quantification of RegIIIγ
mRNA expression in the intestine of mice treated with or without vancomycin. (c)
Quantification of IL-17 mRNA expression in the intestine of mice treated with or
without vancomycin. *p<0.05,** p<0.01. The p value was analyzed by a two-tailed
t-test. Data are the means ± SEM of n=4
Fig. S3 Quantification of the mRNA expression level of IL-22 (a), mBD3 (b) and
mBD4 (c) in the unwounded and wounded skin of mice treated with or without
vancomycin
Reference
1. Muyzer G, de Waal EC, Uitterlinden AG (1993) Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase chain
reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59
(3):695-700