E2F regulates DDB2: consequences for DNA repair in Rb deficient cells.
Sandrine Prost*, Pin Lu, Helen Caldwell, David Harrison.
Queen’s Medical Research Institute, University of Edinburgh, 47 Little France Crescent,
EH16 4TJ, Edinburgh, Scotland, UK
running title :
E2F, DDB2 and nucleotide excision repair
* corresponding author
10
for correspondence
Queen’s Medical Research Institute, University of Edinburgh, 47 Little France Crescent,
EH16 4TJ, Edinburgh
tel : 44 131 242 9163
fax : 44 131 242 6578
email : s.prost@ed.ac.uk
Page 1
Abstract :
DDB2, a gene mutated in XPE patients, is involved in global genomic repair especially
20
the repair of cyclobutane pyrimidine dimers (CPDs) and is regulated by p53 in human
cells. We show that DDB2 is expressed in mouse tissues and demonstrate using primary
mouse epithelial cells, that mouse DDB2 is regulated by E2F transcription factors. Rb, a
tumor suppressor critical for the control of cell cycle progression regulates E2F activity.
Using the Cre-Lox technology to delete Rb in primary mouse hepatocytes we show that
DDB2 gene expression increases, leading to elevated DDB2 protein levels. Furthermore,
we show that endogenous E2F1 and E2F3 bind to DDB2 promoter and that treatment
with E2F1-antisense or E2F1-siRNA decreases DDB2 transcription, demonstrating that
E2F1 is a transcriptional regulator for DDB2. This has consequences for global genomic
repair: in Rb-null cells, where E2F activity is elevated, global DNA repair is increased
30
and removal of CPDs is more efficient than in wild-type cells. Treatment with DDB2siRNA decreases DDB2 expression and abolishes the repair phenotype of Rb-null cells.
In summary these results identify a new regulatory pathway for DDB2 by E2F, which
does not require but is potentiated by p53 ; and demonstrate that DDB2 is involved in
global repair in mouse epithelial cells.
Page 2
Introduction
Nucleotide excision repair (NER) removes a wide variety of DNA lesions, in particular
cyclobutane pyrimidine dimers (CPDs) and <6-4> photoproducts induced by UV. Two
pathways have been identified : transcription-coupled repair (TCR) which preferentially
40
repairs DNA damage within transcribed DNA, and global genomic repair (GGR) that
refers to the repair in the overall genome. Mutation in various genes involved in either
pathway produces xeroderma pigmentosum (XP), rare autosomal recessive diseases
characterised by high incidence of UV-induced cancers. Eight XP complementation
groups have been defined and associated with mutation in specific proteins involved in
NER (for general reviews on NER and XP diseases see (Friedberg et al. 1995)).
Mutations in the DDB2 gene are associated with the XPE complementation group, which
is characterised by deficiency in GGR (Hwang et al. 1999). DDB2 is a small protein
which associates with DDB1 to form the UVDDB complex. This complex is critical as its
binding to CPDs creates a major distortion of the DNA helix leading to the recruitment of
50
XPC and subsequent repair of the damage. Mutation in DDB2 affects UVDDB activity
and compromises GGR, especially the repair of the CPDs.
It has often been written that rodent cells do not express DDB2, have low or no UVDDB
activity or are deficient in GGR. Although this has been clearly demonstrated for Chinese
hamster ovary (CHO) cells (Hwang et al. 1998), and a few mouse fibroblast cell lines
(Tan & Chu 2002; Ishizaki et al. 1994), these data have frequently been inappropriately
extrapolated to all “rodent” cells. In particular, there is some evidence that this is not the
case in certain mouse cells : for example, we have reported that the level of GGR,
especially the repair of CPDs was similar in primary mouse hepatocytes and human
fibroblasts (Prost et al. 1998b). Others have also detected UVDDB activity and DDB2
Page 3
60
expression in some cell lines (Zolezzi & Linn 2000; Tan & Chu 2002). The question of
DDB2 expression and its role in NER in mouse tissues had never been formally assessed
and therefore needed clarification to better understand and appropriately compare murine
with human repair responses.
Human DDB2 expression has recently been shown to be positively regulated by p53, a
transcription factor critical for cellular responses to DNA damage, including DNA repair.
Indeed, p53-deficient cells have reduced GGR, especially the repair of the CPDs, similar
to DDB2 deficient cells (Prost et al. 1998b; Prost et al. 1998a) ((Adimoolam & Ford
2003) and references within). The demonstration that in human cells DDB2 expression is
70
dependent on functional p53, in the presence or absence of DNA damage, provided an
explanation for this phenotype. However the picture remains unclear for mouse cells, in
which Tan and Chu (Tan & Chu 2002) recently showed that unlike in humans, mouse
DDB2 was not regulated by p53 in MEF and a murine liver cell line.
The present study describes a new regulatory pathway for DDB2 in mouse hepatocytes.
Results
DDB2 is expressed in mouse tissues
80
We quantified DDB2 gene expression using real time PCR and checked the level of
protein in nuclear extracts from various mouse tissues (figure 1). Both mRNA (figure 1A)
and protein (1B) could be detected in all tissues tested, at variable levels. Expression was
Page 4
the highest in lung, spleen and kidney, while nuclear levels of protein were greater in
liver and lung. Interestingly, a second band of lower molecular weight was observed in
the spleen (data not shown).
Rb deficiency increases DDB2 expression in a p53 independent manner
DDB2 gene expression was detected in primary hepatocytes regardless of genotype tested
(figure 2A white bars). In p53 null cells, the level of DDB2 gene expression was similar
90
to that of wild type cells (p=0.1312) while was significantly increased in Rb null cells
(p=0.0010). Protein could be immunoprecipitated from cells of all genotypes (data not
shown), however if using western blotting, the protein could be detected only in Rb null
cells , and only from 72 hours after adenovirus infection (figure 2B) at which time the
level of DDB2 transcription is correspondingly at least 2 fold higher than other genotypes
and time points tested (figure 2A).
In human cells, DDB2 has been shown to be regulated by p53 at both basal level and after
DNA damage. We have reported that p53, which is stabilised and activated in
hepatocytes conditionally deficient in Rb (Sheahan et al. 2004), is maximum 72 hours
after plating. We therefore investigated whether the increased DDB2 expression in Rb
100
null cells was due to the overexpression of p53. Interestingly, Rb loss in p53 null cells
was still able to increase DDB2 expression, although to a less substantial level than in
cells with functional p53 (figure 2C). This suggests that p53 is not strictly required for
induction of DDB2 after the loss of Rb, but is necessary to achieve a maximum induction
of DDB2 expression in undamaged cells (figure 2C).
In human cells, DDB2 has been shown to be activated after UV-induced DNA damage in
a p53-dependent manner. After UV however, DDB2 expression levels remained
Page 5
unchanged, in wild type (wt), p53-/- or Rb null hepatocytes (figure 2A compare white and
black bars).
Taken together, these results show that in primary mouse hepatocytes, DDB2 expression
110
is not upregulated after UV damage, in agreement with Tan and Chu (Tan & Chu 2002),
but that acute loss of Rb affects the basal level of DDB2, to some extent through p53.
Increased DDB2 expression effects global DNA repair
Human DDB2 is involved in global genomic repair (GGR), especially the repair of CPDs.
We assessed global DNA repair by quantifying unscheduled DNA synthesis (UDS) in wt
and Rb null cells in which DDB2 expression is increased (figure 3). The cells were UVirradiated (10J/m2) to induce DNA damage and cultured in the presence of tritiated
thymidine. Repair synthesis was then quantified by counting the number of radioactive
grains revealed on a photoemulsion (examples are shown on the photos figure 3A). The
120
grain index reflects the incorporation of tritiated thymidine and therefore the DNA repair
synthesis. In untreated cells, the level of incorporation is low in more than 99 % of the
cells, showing that no DNA synthesis is occurring. One percent or less cells are found in
replicative DNA synthesis and have a grain index of 100. After UV-irradiation, the grain
density increased, regardless of genotype, reflecting DNA repair synthesis (figure 3A,
3B, 3C). The box plot representation of grain indexes shows that unscheduled DNA
synthesis increases after Rb deletion (figure 3B, p<0.0001). In p53-/- cells, in which we
have previously reported a lower level of UDS than in wild type cells (Prost et al. 1998b;
Prost et al. 1998a), an increase in UDS is also consistently observed after Rb deletion
(figure 3C) ; although it did not reach statistical significance (p=0.1814). This may
Page 6
130
indicate that the effect of Rb on unscheduled DNA repair synthesis does not require
functional p53.
In order to confirm the role of DDB2 in the repair phenotype of Rb null hepatocytes, we
treated the cells with DDB2 siRNA. This treatment reduced significantly the level of
DDB2 RNA in the cells, to the level of untreated wild type cells (figure 3D) and
prevented the increases in UDS (figure 3A compare photos (e) and (f) ; figure 3E)
(p<0.0001 in both wt and Rb -/- cells treated with SiRNA).
The technique of UDS does not discriminate between the repair of <6-4> photoproducts
and CPDs. In fact, as UDS quantifies the repair within the 4 first hours after UV
treatment and repair of the <6-4> photoproducts is described to be 5 to 10 time faster
140
than the repair of the CPDs, in some systems UDS is likely to reflect mainly the repair of
the <6-4> photoproducts. However, as CPDs are more abundant than <6-4>
photoproducts ( 75% versus 25 % ) after UV treatment, and as in primary hepatocytes,
removal of CPDs and <6-4> photoproducts appear to have closer kinetics of repair (40 %
of <6-4> versus 30 % of CPDs repaired 4 hours after UV (Prost et al. 1998b; Prost et al.
1998a)), it is likely that the difference in UDS observed is mainly due to the removal of
CPDs.
To refine the UDS result we then investigated the ability of wt & Rb -/- cells to
specifically repair CPDs. We labelled the CPDs by immunofluorescence using a specific
CPD antibody (a gift from T Mori) at indicated times after UV irradiation (figure 3G).
150
The images were capture under identical conditions in cells treated in parallel as
described in materiels and methods. All parameters were precisely set to be constant,
allowing for quantification analysis. In wild type cells, the labelling of CPDs decreases
slowly with time (figure 3G & H) usually becoming detectable by eye around 50 hours
Page 7
after UV. By contrast in Rb -/- cells, the intensity of CPDs labelling diminishes visibly as
early as 6 hours after UV. This confirms that Rb -/- cells are repairing CPDs faster than
wild type cells. Interestingly, complete removal of the CPDs was not achieved even in
Rb-/- cells, 96 hours after UV (data not shown). Treatment of Rb null cells with DDB2
SiRNA for 24 hours delayed the repair of the CPDs in Rb-/- hepatocytes (figure 3G&H).
160
E2F activates transcription of DDB2 with consequences for global DNA repair.
As Rb deletion does not require functional p53 to affect DDB2 expression levels (figure
2B), we analysed the mouse DDB2 promoter region (Ensembl Gene ID
ENSMUSG00000002109) and identified a putative E2F binding site (also mentioned in
(Nichols et al. 2003) located 143 to 136 nucleotides upstream of the translation initiation
site. We have previously shown that E2F transcriptional activity is elevated in Rb null
hepatocytes (Sheahan et al. 2004). We therefore tested the hypothesis that in murine cells
DDB2 expression is regulated by E2F.
170
As several studies have reported a role for E2F1 in DNA damage response (Stevens et al.
2004 and therein) and as in hepatocytes, whether wild type of Rb null, we found that
E2F1 gene expression is about 4-fold higher than either E2F2 or E2F3 (data not shown)
we concentrated on the effect of E2F1 inhibition.
Using an antisense against E2F1, we reduced E2F activity, together with DDB2 gene
transcription (figure 4A, 4B). This was accompanied by a reduction of unscheduled DNA
synthesis (figure 4C) (p<0.000 for wt and p=0.001 for Rb-/- cells) suggesting that E2F1 is
responsible for DDB2 activation and increased DNA repair.
Page 8
However, the decrease in E2F activity after treatment with the E2F1 antisense was
somewhat stronger than expected. Indeed, the majority of E2F target promoters are
180
regulated by several E2Fs (Ishida et al. 2001, Attwooll et al. 2004 and therein), and
E2F2 and E2F3, which are also regulated by Rb, should therefore contribute to this
reporter activity. It was suspected that the E2F1 antisense may also inhibit E2F2 and
E2F3 activity, despite no decrease in the mRNA level (supplementary figure). We
therefore repeated this experiment using a siRNA against E2F1. As previously shown
with the antisense, the siRNA against E2F1 decreased efficiently E2F1 RNA level, but
not E2F2 or E2F3 (supplementary figure), and to a lesser extent DDB2 (figure 5)
suggesting that E2F1 may regulate DDB2 expression.
To confirm this, we then performed CHIP assay. Hepatocytes in culture were lysed and,
proteins bound to the DNA were crosslinked as described in methods. After appropriate
190
shearing, the DNA-protein complex was immunoprecipitated with 2 different antibodies
against E2F1. Both antibodies pulled down DNA fragments which were amplified with
primers specific for the 210bp sequence surrounding the putative E2F site (data not
shown and figure 6A), showing that E2F1 does bind to this sequence in murine
hepatocytes. Although some specificity have been described (takahashi 2000). the
majority of E2F target promoters seem to be regulated by several E2Fs (Ishida 2001,
Attwooll 2004 and therein). We therefore repeated the Chip analysis for E2F2 and E2F3
and found that E2F3 but not E2F2 was able to bind DDB2 promoter. Interestingly, E2F3
binding was increased in Rb null cells (figure 6B). E2F3 expression is unchanged in Rb
null cells (data no shown) but the transactivation ability of a particular E2F may be
200
conferred by the binding to protein partners (Attwooll 2004) and does not simply depends
on its level of expression (Muller 2006). This may explain the higher binding of E2F3 in
Page 9
Rb null hepatocytes and also indicates that in some circumstances E2F2 could contribute
to DDB2 expression, even if no binding was observed here.
210
Discussion
DDB2 is expressed in mouse tissues and affects DNA repair
The present results establish that DDB2 is expressed in mouse tissues, including in the
liver where the nuclear protein level is high. The differences between expression and
quantity of protein observed in the liver and lung suggest that mouse DDB2 protein is
likely to be regulated by both posttranslational modifications and regulation of gene
expression, as described in human cells (Nag et al. 2001). DDB2 gene expression and
protein were also detected in primary hepatocytes. With these primary cells, using siRNA
technology we were able to demonstrate that mouse DDB2 does have a role in global
genomic repair, and specifically in the repair of CPDs. Our experiments do not rule out
220
the possibility of DDB2 also having an effect on the repair of <6-4> photoproducts.
Indeed, although expression of human DDB2 has no effect on the repair of <6-4>
photoproducts in hamster cells (in which DDB2 is not normally expressed), it does have
an effect in human cells : the repair of <64> is mildly defective in XPE patients ((Tang &
Page 10
Chu 2002) and references therein), and low levels of UVDDB stimulate the excision of
<6-4> photoproducts by 2 fold (Wakasugi et al. 2002).
We also show for the first time that loss of Rb upregulates DDB2 and GGR by means of
increased E2F activity. We have shown that E2F1 antisense or siRNA decreased DDB2
expression and DNA repair. Moreover, we show that both E2F1 and E2F3 are able to
230
bind the DDB2 promoter. The recent finding from Berton et al (Berton et al. 2005)
showing that E2F1 deficient mice have impaired DNA repair supports our finding that
E2F effects DNA repair by means of regulation of repair proteins including DDB2.
Intriguingly both DDB2 and E2F1-3 are normally cell cycle regulated. In human cell
lines in culture, through a combination of posttranslational modification and increased
gene expression (Nag et al. 2001) DDB2 protein increases during G1/S and peaks in S
phase. Similarly, we observed in wild type mouse primary hepatocytes that DDB2 mRNA
& protein levels were maximum in S phase (figure 2 A and data not shown). The basis of
this cell cycle regulation has never been investigated, but our demonstration that E2F1
and E2F3 are able to bind to a consensus site situated in the 5’untranslated region of the
240
gene and that decrease E2F1mRNA levels by siRNA or antisense is associated with a
decreased DDB2 expression proves that E2F regulates the expression of mouse DDB2, at
least in hepatocytes. This finding provides for the first time a plausible mechanism for the
cell cycle regulation of expression of DDB2 as upon Rb phosphorylation in G1/S, E2F
activity also increases to peak in S phase (for reviews see (Muller & Helin 2000; Dyson
1998)). Whether E2F transcriptionaly regulates DDB2 in other species remains to be
confirmed, but the identification of an E2F site downstream of the initiation of
Page 11
transcription site in human DDB2 suggests that this may also be the case in human cells
(Nichols et al. 2003).
250
DDB2 is not activated by p53
We (Prost et al. 1998b; Prost et al. 1998a) and many other groups (reviewed in
(Adimoolam & Ford 2003)) have shown that p53 is involved in NER in both human and
mouse cells and that loss of p53 function affects GGR, but not TCR (Prost et al. 1998b;
Ford & Hanawalt 1997; Ford & Hanawalt 1995; Zhu et al. 2000). This effect is more
specific to the removal of CPDs than another UV-induced damage (6-4 photoproducts).
These characteristics are similar to those of XPE cells bearing mutation in the DDB2
260
gene.
Human DDB2 expression has been shown to be regulated by p53 at both basal level and
after DNA damage (Hwang et al. 1999) when p53 binds to a consensus site in the
5’untranslated region of DDB2 gene and stimulates DDB2 transcription (Tan & Chu
2002).
In a recent paper Wang et al (Wang et al. 2004) demonstrated in human cells that DDB2
is a downstream effector of p53 which recognises CPDs and can stimulate XPC
recruitment and binding at the site of damage (Fitch et al. 2003a). This provides a clear
explanation for the defect in global repair in p53-deficient human cells : lack of DDB2
jeopardises the recruitment of XPC to the site of DNA damage and thus repair (Wang et
270
al. 2004).
Page 12
Basal level of expression of DDB2 was similar in wild type and p53 null cells (figure 2
A). Furthermore, DDB2 expression did not significantly increase after UV irradiation in
primary mouse hepatocytes (figure 2A) despite stabilisation and activation of p53 (30).
This suggests that murine p53 does not directly regulate DDB2 gene expression, unlike in
human cells and is supported by a recent study showing that murine p53 is unable to bind
the sequence corresponding to the p53 binding site identified in humans (Tan & Chu
2002). Interestingly however, although Rb deletion resulted in increased DDB2 gene
expression regardless of p53 genotype (figure 2C), the effect was maximum in the
presence of functional p53. The precise mechanism for this potentiation of the effect by
280
p53 is unknown but physical interaction of p53 with E2F1 (O'Connor et al. 1995) or other
transcription factors (Ragimov et al. 1993) could be involved.
DDB2 & transcription
E2F activity is critical for the G1/S transition and is therefore tightly regulated. It has
previously been shown that DDB2 interacts with E2F1, and, together with DDB1
stimulates E2F1 activated transcription (Hayes et al. 1998; Shiyanov et al. 1999), (also
reviewed in (Tang & Chu 2002)). Our results support the hypothesis that in
untransformed primary mouse epithelial cells, activation of DDB2 by E2F could be
290
critical for the regulation of the G1/S transition. In undamaged cells, DDB2 is activated
by E2F, and in turn cooperates with DDB1 and E2F1 to transcriptionaly activate genes
required for DNA replication and G1/S transition. However, after DNA damage, DDB2’s
main function as a transcription cofactor switches to global repair, and the pool of
protein, whose expression is not further activated in primary mouse hepatocytes, is likely
Page 13
to relocate to the site of damage as shown by Fitch et al using DDB2 overexpression
systems (Fitch et al. 2003a; Fitch et al. 2003b). This decrease in available DDB2 would
reduce the number of UVDDB-E2F1 complexes so reducing E2F1 transcriptional activity
and promoting cell cycle arrest, as observed when the paramyxovirus simian virus 5v
protein sequesters DDB2 protein (lin et al. 2000).
300
In conclusion we show here that all mouse tissues tested express DDB2. Using mouse
primary hepatocytes of various genotypes together with siRNA and antisense technology,
we show, in an authentic, non immortalised system that DDB2 is regulated by E2F but
not p53, and is involved in DNA repair, especially the repair of the CPDs. As the cells are
not immortalised or selected for a deficiency, as no overexpression system is used, and as
the phenotype is observed rapidly after Rb deletion, it is thought to reflect an authentic
regulation rather than an artefact of cell culture or adaptation. Therefore while mouse and
human cells share a requirement for DDB2 in normal NER, they differ in requirement for
310
p53 to regulate this process, but we have identified a new downstream regulatory role for
E2F in DDB2 function which is important to mouse and perhaps human cells.
Materials & Methods
Hepatocyte isolation, culture and adenovirus infection.
The mice used were produced by crossing p53-/- (Purdie et al. 1994) with Rb-floxed
mice that are homozygous for the Rb-floxed allele (exon 19 of the Rb gene is flanked by
LoxP sequences) (Vooijs et al. 2002). Wild-types were littermates of the genetically
Page 14
modified animals. Primary hepatocytes, from adult mice (male, 6-12 weeks old), were
320
isolated by two-step retrograde perfusion as previously described (Sheahan et al. 2004).
Rb -/- cells are obtained by deletion of the Rb-floxed alleles in vitro by infection with an
adenovirus expressing Cre-recombinase (as we previously described (Prost et al. 2001)).
Deletion of Rb is completed within 16 to 24 hours after infection (Prost et al. 2001).
Upon Rb deletion, Rb -/- hepatocytes exhibit a high level of p53 which is active for
transcriptional activation (Sheahan et al. 2004).
DNA repair
For DNA repair studies, cells were UV-irradiated using a spectrolinker XL-1500
(Spectronics Corporation) fitted with UV-C bulbs (254nm).
330
Unscheduled DNA synthesis was quantified as published previously (Prost et al. 1998b).
Briefly, cells were cultured in the presence of tritiated thymidine for 3 hours after 10J/m2.
After 1 hour chase, the slides were fixed, stained and covered with an autoradiographic
emulsion (LM-1 – Amersham). Nuclear grain counting was performed using image
analysis software (Kontron 3.4). At the time of the experiments, less than 1 % of the
hepatocytes are in S phase, and replicative DNA synthesis is easily detectable with a
grain index above 80. Box Plot representation allows all the data to be plotted, a cell
undergoing replicative DNA synthesis appears as an outliner and does not affect the
overall result.
DNA repair of cyclobutane pyrimidine dimers (CPDs) was quantified by
340
immunofluorescence immediately after or various times after UV irradiation (10J/m2).
Cells were treated with ice-cold detergent (0.5% Triton, 0.2mg/ml EDTA, 1% BSA) and
Page 15
fixed in acetone/methanol (1:1 v/v). Immunodetection of CPDs was performed as
previously described (Nishiwaki et al. 2004) using TDM-2 antibody (Mori et al. 1991)
1/5000 (a kind gift of Toshio Mori), and revealed by a Alexa 488 rabbit anti-mouse
secondary antibody. Nuclear counterstain is TO-PRO-3. Images were taken using a Zeiss
LSM5-10 inverted confocal microscope using multitracking. Comparisons were made
between cells that were treated, fixed and stained and imaged on parallel on the same
days. The conditions used for the confocal analysis are very precisely set to be consistant
(the laser intensity, gain, pin hole settings and time for exposure are kept constant for the
350
whole series of images). An Argon/Krypton laser was used to excite FITC at 488 nm at
6.1A. The confocal aperture pinhole was set digitally at 17 m. The image was visualized
with a Zeiss Plan-Neofluar 40×/1.3 Oil DIC oil immersion objective. The
contrast/brightness setting was selected so that the image for bright cells would not
exceed be saturated (less than 255 for pixel intensity). All of the settings were kept
constant throughout the analysis to yield unbiased measurements for each set of
comparisons. Focus was done on randomly selected fields while “fast-scanning” for green
immunofluorescence (CPD). The adjacent field was then scanned for green and blue
fluorescence using multitracking scanning with 4 lines average and a digital image was
acquired at a resolution of 1024x1024. The intensity of nuclear green fluorescence in
360
each cell was quantified for using Image-pro plus software. An average of 40 cells were
quantified per condition.
Page 16
Immunodetection of DDB2 protein
For primary hepatocytes : Total cell proteins were separated on a 10% SDS-PAGE,
transferred to nitrocellulose, probed with anti DDB2N antibody (directed against the Nterminal part of the protein) 1:50 for three hours at room temperature (Zymed
Laboratories ZMD06 Cat. no. 34-2400) and revealed by the appropriate HRP secondary
370
antibody (1:2000) (Dako) and ECL+. To confirm loading, The blot was probed using an
anti-Actin antibody (AB8227, AbCam).
For tissues : Nuclear extract was prepared from murine tissues as previously described
(Nag et al. 2001). Immunoprecipitation was performed from equal amount of protein
(400µg) using TrueBlotTM (eBioscience) according to the manufacturer instruction using
an antibody directed against the C-terminal part of the protein (DDB2C, Zymed
Laboratories ZMD10, Cat. no. 33-2800). The samples were run on a gel, transferred and
detected using the different anti-DDB2N antibody to the N-terminal part of the protein as
described above, and the secondary antibody provided in the immunoprecipitation kit.
Hence DDB2 protein was precipitated and immunodetected using independent antibodies
380
to different parts of the protein.
ChIP for DDB2
The DDB2 mouse gene (Ensembl Gene ID ENSMUSG00000002109) was analysed and a
putative E2F binding site, also reported by others (Nichols et al. 2003) was identified
located 143 to 136 nucleotides upstream the translation initiation site.
Protein/DNA cross-linking was performed 96 hours after cell plating by treatment with
1% formaldehyde at 37C for 10 minutes. Cells were then lysed and DNA sheared by
sonication, resulting in mainly 500-750 bp long DNA pieces. Immunoprecipitation was
Page 17
done using two different antibodies against E2F1 (Biomeda CA, US, and NeoMarkers,
390
CA, US) , against E2F2 (SantaCruz, SC633, clone C-20) or E2F3 (SantaCruz SC878,
clone C-18) and protein-A agarose. Immunoprecipitated DNA was purified and subjected
to PCR using primers that covers DDB2 regulatory element (5’
CAAGACAGAAAATACTGTG 3’ and 5’CGAAGCAAGGAGTGGAAAAG 3’) where
the putative site for E2F was identified. The expected PCR product is 210 bp long.
E2F activity
Hepatocytes in culture for 48 hours were transfected using TFx-50 (Promega Biotech)
reagent (ratio 1/5 w/w DNA/lipid) as previously described (Prost et al. 1998b). To control
for transfection efficiency cells were transfected with a mixture of pCMV, constitutively
400
expressing Lac Z and pE2F-TA-Luc (MercuryTM pathway profiling system Clontech)
(ratio 1/10). Twenty four hours after transfection, cells were scraped, luciferase and Gal
activities were quantified using Luciferase and Galactosidase Assay reagents according
to the manufacturer (Promega).
Antisense treatment
Mouse specific E2F1 antisense and control antisense were purchased from Biognostik,
Germany (Cat. no. 11855-0203). A mixture of 3 E2F1-specific or 3 control antisenses
(100 ) was added into the culture medium (50 l of the mix per 6cm plates) from 10
hours after isolation. Medium was changed and more antisense was added every 24
410
hours.
Page 18
SiRNA treatment
siGENOME SMARTpool siRNA mouse E2F1 (Cat. No.M-044993-01) and mouse
DDB2 (M-044959-00) were purchased from Dharmacon (Lafayette, Colorado, US).
These siRNA products are pools of four SMARTselection designed siRNA duplexes
targeting mouse E2F1 and DDB2 mRNA transcripts respectively. SiGLO cyclophilin B
siRNA was used as a positive control of transfection efficiency. Hepatocytes were plated
in 6-well plates and treated with CRE or DL70 adenovirus. At indicated times, the culture
medium was replaced by medium containing 100 nM siRNA and 0.8% of
420
DharmaFECT 1.1 (T-2001-02) transfection reagents, leading to a transfection
efficiency above 70%.
SiRNA was added 24 to 48 hours before fixing for analysis or harvesting cells for real
time PCR experiments.
Quantitative real-time PCR
Total RNA was harvested at indicated times after virus infection, using Qiagen RNeasy
mini-column (Cat.No.74104). Total RNA was eluted from the column in nuclease-free
water before being re-concentrated by ethanol precipitation. Normally about 1-3 g total
RNA was obtained from the cells in a single well of a 6-well plate. A260/A280 ratios
430
were measured by spectrophotometer Biomate 3 and were between 1.8 and 2.0. The RNA
quality was also examined on RNA 6000 Nano LabChip by an Agilend Bioanalyzer
(Agilent). cDNA was synthesized using MMLV (Qiagen) reverse transcriptase and an
Oligo-dT primer. RNA templates were removed at the end of reaction by RNase H. The
efficiency of the reverse transcription was examined by PCR using a pair of -actin
Page 19
primers.
We used Applied Biosystems’s Taqman assays products and the reactions were run on an
ABI Prism 7900 Sequence Detection System (AME Bioscience). The genes studied were
Gapd (MM99999915_q1), E2f1 (MM00432939_m1) and DDB2 (MM00651374_m1).
440
Statistical analysis
Analyses were done with Minitab for Windows (version 13.0). For unscheduled DNA
synthesis, the nuclear index was Arcsin-transformed, and analysis of variance was
performed using General Linear Model, with, when appropriate comparison with control
using Bonferroni test. For expression levels, differences between means were evaluated
with Analysis of Variance (ANOVA). Satisfactory homogeneity of variances was
determined with Bartlett’s test. Differences were taken to be significant if p<0.05.
Acknowledgment
450
We thank Chris Bellamy for critical comments on the manuscript. The Rb-floxed
(Rblox/lox) mice were a kind gift from Anton Berns (Netherlands Cancer Institute,
Amsterdam) to whom we are very grateful. Many thanks to Toshio Mori for kindly
providing us with the TDM-2 antibody. We are very grateful to Sharon Sheahan for
providing primers for E2F1 and E2F2; and antibodies against E2F2 & E2F3, without
which we would not have been able to complete this study. This work was supported by
grant from the Melville Trust for the Care and Cure of Cancer to SP.
Page 20
References
460
Adimoolam, S. & Ford, J. M. (2003) p53 and DNA damage inducible expression of the
xeroderma pigmentosum group C gene. DNA Repair (Amst), 2, 947-954.
Attwooll C, Lazzerini DE, Helin K. The E2F family: specific functions and overlapping
interests. EMBO J. 2004; 23: 4709-4716
Berton, T. R., Mitchell, D. L., Guo, R. & Johnson, D. G. (2005) Regulation of epidermal
apoptosis and DNA repair by E2F1 in response to ultraviolet B radiation. Oncogene, 24,
2449-2460.
Dyson, N. (1998) The regulation of E2F by pRB-family proteins. Genes Dev., 12, 22452262.
470
Fitch, M. E., Cross, I. V. & Ford, J. M. (2003a) p53 responsive nucleotide excision repair
gene products p48 and XPC, but not p53, localize to sites of UV-irradiation-induced
DNA damage, in vivo. Carcinogenesis, 24, 843-850.
Fitch, M. E., Nakajima, S., Yasui, A. & Ford, J. M. (2003b) In vivo recruitment of XPC
to UV-induced cyclobutane pyrimidine dimers by the DDB2 gene product. J.Biol.Chem.,
278, 46906-46910.
Ford, J. M. & Hanawalt, P. C. (1995) Li-Fraumeni syndrome fibroblasts homozygous for
p53 mutations are deficient in global DNA repair but exhibit normal transcriptioncoupled repair and enhanced UV resistance. Proc.Natl.Acad.Sci.U.S.A, 92, 8876-8880.
Page 21
Ford, J. M. & Hanawalt, P. C. (1997) Expression of wild-type p53 is required for efficient
480
global genomic nucleotide excision repair in UV-irradiated human fibroblasts.
J.Biol.Chem., 272, 28073-28080.
Friedberg, E. C., Walker, G. C. & Siede, W. (1995) DNA repair and mutagenesispp. 283366. ASM Press, Washington.
Hayes, S., Shiyanov, P., Chen, X. & Raychaudhuri, P. (1998) DDB, a putative DNA
repair protein, can function as a transcriptional partner of E2F1. Mol.Cell Biol., 18, 240249.
Hwang, B. J., Ford, J. M., Hanawalt, P. C. & Chu, G. (1999) Expression of the p48
xeroderma pigmentosum gene is p53-dependent and is involved in global genomic repair.
Proc.Natl.Acad.Sci.U.S.A, 96, 424-428.
490
Hwang, B. J., Toering, S., Francke, U. & Chu, G. (1998) p48 Activates a UV-damagedDNA binding factor and is defective in xeroderma pigmentosum group E cells that lack
binding activity. Mol.Cell Biol., 18, 4391-4399.
Ishida S, Huang E, Zuzan H, Spang R, Leone G, West M, Nevins JR. Role for E2F in
control of both DNA replication and mitotic functions as revealed from DNA microarray
analysis. Mol.Cell Biol. 2001; 21: 4684-4699
Ishizaki, K., Ejima, Y., Matsunaga, T., Hara, R., Sakamoto, A., Ikenaga, M., Ikawa, Y. &
Aizawa, S. (1994) Increased UV-induced SCEs but normal repair of DNA damage in
p53-deficient mouse cells. Int.J.Cancer, 58, 254-257.
Page 22
Lin, G. Y., Paterson, R. G., Richardson, C. D. & Lamb, R. A. (2000) The V protein of
500
paramyxovirus SV5 interacts with damage-specific DNA binding protein. Virology, 249,
189-200.
Mori, T., nakane, M., hattori, T. K. N., Matsunaga, T., ihara, M. & Nikaido, O. (1991)
Selective regulation of T cell IL-5 synthesis by OM-01, JTE-711 and p38 MAP kinase
inhibitor: independent control of Th2 cytokines, IL-4 and IL-5. Photochem.Photobiol.,
54, 225-232.
Muller, H. & Helin, K. (2000) The E2F transcription factors: key regulators of cell
proliferation. Biochim.Biophys.Acta, 1470, M1-12.
Nag, A., Bondar, T., Shiv, S. & Raychaudhuri, P. (2001) The xeroderma pigmentosum
group E gene product DDB2 is a specific target of cullin 4A in mammalian cells.
510
Mol.Cell Biol., 21, 6738-6747.
Nichols, A. F., Itoh, T., Zolezzi, F., Hutsell, S. & Linn, S. (2003) Basal transcriptional
regulation of human damage-specific DNA-binding protein genes DDB1 and DDB2 by
Sp1, E2F, N-myc and NF1 elements. Nucleic Acids Res., 31, 562-569.
Nishiwaki, Y., Kobayashi, N., Imoto, K., Iwamoto, T. A., Yamamoto, A., Katsumi, S.,
Shirai, T., Sugiura, S., Nakamura, Y., Sarasin, A., Miyagawa, S. & Mori, T. (2004)
Trichothiodystrophy fibroblasts are deficient in the repair of ultraviolet-induced
cyclobutane pyrimidine dimers and (6-4)photoproducts. J.Invest Dermatol., 122, 526532.
Page 23
O'Connor, D. J., Lam, E. W., Griffin, S., Zhong, S., Leighton, L. C., Burbidge, S. A. &
520
Lu, X. (1995) Physical and functional interactions between p53 and cell cycle cooperating transcription factors, E2F1 and DP1. EMBO J., 14, 6184-6192.
Prost, S., Bellamy, C. O., Cunningham, D. S. & Harrison, D. J. (1998a) Altered DNA
repair and dysregulation of p53 in IRF-1 null hepatocytes. FASEB J., 12, 181-188.
Prost, S., Ford, J. M., Taylor, C., Doig, J. & Harrison, D. J. (1998b) Hepatitis B x protein
inhibits p53-dependent DNA repair in primary mouse hepatocytes. J.Biol.Chem., 273,
33327-33332.
Prost, S., Sheahan, S., Rannie, D. & Harrison, D. J. (2001) Adenovirus-mediated Cre
deletion of floxed sequences in primary mouse cells is an efficient alternative for studies
of gene deletion. Nucleic Acids Res., 29, E80.
530
Purdie, C. A., Harrison, D. J., Peter, A., Dobbie, L., White, S., Howie, S. E., Salter, D.
M., Bird, C. C., Wyllie, A. H., Hooper, M. L. & . (1994) Tumour incidence, spectrum and
ploidy in mice with a large deletion in the p53 gene. Oncogene, 9, 603-609.
Ragimov, N., Krauskopf, A., Navot, N., Rotter, V., Oren, M. & Aloni, Y. (1993) Wildtype but not mutant p53 can repress transcription initiation in vitro by interfering with the
binding of basal transcription factors to the TATA motif. Oncogene, 8, 1183-1193.
Sheahan, S., Bellamy, C. O., Treanor, L., Harrison, D. J. & Prost, S. (2004) Additive
effect of p53, p21 and Rb deletion in triple knockout primary hepatocytes. Oncogene, 23,
1489-1497.
Page 24
Shiyanov, P., Hayes, S. A., Donepudi, M., Nichols, A. F., Linn, S., Slagle, B. L. &
540
Raychaudhuri, P. (1999) The naturally occurring mutants of DDB are impaired in
stimulating nuclear import of the p125 subunit and E2F1-activated transcription. Mol.Cell
Biol., 19, 4935-4943.
Stevens C, La Thangue NB. The emerging role of E2F-1 in the DNA damage response
and checkpoint control. DNA Repair (Amst) 2004; 3: 1071-1079
Tan, T. & Chu, G. (2002) p53 Binds and activates the xeroderma pigmentosum DDB2
gene in humans but not mice. Mol.Cell Biol., 22, 3247-3254.
Tang, J. & Chu, G. (2002) Xeroderma pigmentosum complementation group E and UVdamaged DNA-binding protein. DNA Repair (Amst), 1, 601-616.
Vooijs, M., te, R. H., van, d., V & Berns, A. (2002) Tumor formation in mice with
550
somatic inactivation of the retinoblastoma gene in interphotoreceptor retinol binding
protein-expressing cells. Oncogene, 21, 4635-4645.
Wakasugi, M., Kawashima, A., Morioka, H., Linn, S., Sancar, A., Mori, T., Nikaido, O.
& Matsunaga, T. (2002) DDB accumulates at DNA damage sites immediately after UV
irradiation and directly stimulates nucleotide excision repair. J.Biol.Chem., 277, 16371640.
Wang, Q. E., Zhu, Q., Wani, G., Chen, J. & Wani, A. A. (2004) UV radiation-induced
XPC translocation within chromatin is mediated by damaged-DNA binding protein,
DDB2. Carcinogenesis, 25, 1033-1043.
Page 25
Zhu, Q., Wani, M. A., El Mahdy, M. & Wani, A. A. (2000) Decreased DNA repair
560
efficiency by loss or disruption of p53 function preferentially affects removal of
cyclobutane pyrimidine dimers from non-transcribed strand and slow repair sites in
transcribed strand. J.Biol.Chem., 275, 11492-11497.
Zolezzi, F. & Linn, S. (2000) Studies of the murine DDB1 and DDB2 genes. Gene, 245,
151-159.
570
Figure legends
Figure 1 : DDB2 gene expression and protein level in mouse tissues.
A : real time PCR for DDB2 in mouse tissues. The figure shows a box plot representation
of the relative expression of DDB2 corrected for GAPDH expression in mouse tissues
isolated from 5 wild type mice (3 for thymus).
B : DDB2 protein levels in mouse tissues. DDB2 was immunoprecipitated from similar
amounts of nuclear extract prepared from various mouse tissues. Immunoprecipitation
was performed using an antibody recognising the C-terminal part of the protein, while
detection used an antibody recognising the N-terminal of the protein. The negative
control omits any cell extract.
580
Page 26
Figure 2 : DDB2 expression in wild type and Rb null hepatocytes
A: DDB2 expression in cells of various genotypes : Real time PCR was performed at
indicated times in wild type (wt), p53-/- and Rb -/- hepatocytes treated or not with UV
(10J/m2, 6 hours after plating).
B : Western blotting for DDB2 in primary hepatocytes treated with adenovirus control
DL70 (wild type cells) or adenovirus expressing Cre (Rb-/- cells). Actin probing is shown
as loading control.
C: DDB2 gene expression increases after Rb deletion. The increased DDB2 expression
590
associated with Rb deletion is expressed as a ratio of the expression in control cells
treated with Dl70 adenovirus (wt for Rb and either wild type or null for p53). The
quantification was performed using real time PCR, and the results are fold increase in Rb
null cells +/- SEM for 2 (for p53-\- & p53 Rb-/- in white) to 6 ( for wt & Rb-/- in black)
independent experiments.
Figure 3: Effect of the loss of Rb on unscheduled DNA synthesis (UDS) and CPDs
removal
A: Photos representative of UDS grain index for a) wild type untreated hepatocytes not
600
undergoing replicative DNA synthesis (>99%), b) UDS in wild type hepatocytes treated
with UV, c) untreated hepatocytes undergoing DNA synthesis (<1%), d) Rb-/- untreated
hepatocytes, e) UDS in Rb-/- hepatocytes treated with UV, f) UDS in Rb-/- hepatocytes
treated with siRNA DDB2 and UV. All photos were taken at x40 magnification.
B : UDS in wt & Rb -/- cells. C: UDS in p53-/- & p53-/-Rb-/- cells. (B & C) :
Quantification was performed as described in methods. The graphs are Boxplot
Page 27
representations of the nuclear grain index of at least 100 nuclei in cells treated or not with
10J/m2. Unirradiated cells show low incorporation of tritiated thymidine reflecting the
absence of replicative DNA synthesis at the time of experiment. Few cells (0 of 113 wt, 1
of 146 Rb-/-, 0 of 101 p53-/- & 2 of 123 p53 Rb-/- hepatocytes) were in S phase at the
610
time of experiment. The grain index for these cells appears as outliners in the box plot
and does not affect the results. Graphs are from one typical experiment performed 3 (for
p53-/- genotypes ) to 5 times.
(D-F) : DDB2 siRNA decreases both global genomic repair and removal of CPDs in Rb /- cells
D: DDB2 expression is reduced after 24 hours of siRNA DDB2 treatment. This typical
experiment shows the reduction of DDB2 expression obtained in the wild type (wt) and
Rb-/- cells treated with SiDDB2, of part F. Controls are cells treated with siGLO.
E: Unscheduled DNA synthesis. White box : wild type cells (wt), black box : Rb-/- cells.
Rb-/-siRNA : Rb-/- cells treated with DDB2 siRNA for 24 hours
620
F : diagrammatic representation of the experiment. Time after isolation of the hepatocytes
(“p” time for perfusion) and time after UV treatment (“t” time for treatment) are shown
for UDS and CPDs immunodetection experiments. In all experiments the cells were
treated for 24 hours with SiRNA (shown as a red bar). p0, time of hepatocytes plating and
adenovirus infection, t0 time of UV treatment.
G & H : Removal of CPDs.
G : Immunofluorescence for CPDs (green) was performed on untreated cells (No UV, top
photos) and at indicated times after 10J/m2, and the nuclei were counterstained using TOPRO-3 (blue). Where indicated Rb-/- cells were treated with DDB2 siRNA 6 hours after
Page 28
UV-irradiation for 24 or 44 hours. The photos are of one typical experiment repeated 2
630
(for siRNA) to 4 times.
H : Quantification of CPD immunofluorescence. The intensity of green fluorescence was
quantified as described in methods. The graph shown the average green fluorescence +/SDV in wild type, Rb null and Rb null cells treated with DDB2 SiRNA
Figure 4 : E2F1 antisense decreases E2F1 activity, DDB2 expression and UDS in wild
type (hepatocytes infected by adenovirus DL70 – white bars) or Rb -/- cells (hepatocytes
infected with adenovirus Cre – black bars)
A: reporter assay for E2F activity. Hepatocytes were transfected with an E2F reporter
640
plasmid and treated with either a control antisense (AS) or E2F1 antisense. The bars
represent the reporter gene activity 72 hrs after infection, 30 hrs after transfection.
B : DDB2 gene expression quantified by real time PCR. The results are expressed relative
to GAPDH expression. Treatment with E2F1 antisense reduces the transcription of DDB2
in Rb-/- cells.
C: Unscheduled DNA synthesis. Incorporation of tritiated thymidine was quantified as
previously in wild type (white bars) and Rb -/- (black bars) hepatocytes treated with
either a control antisense or E2F1 antisense. E2F1-AS decreases UDS.
650
Figure 5 : E2F1 siRNA decreases DDB2 expression
Wild type (white bars) and Rb-/- (black bars) hepatocytes were treated with siRNA
against E2F1 for 48hrs when real time PCR for E2F1 (A) and DDB2 (B) were performed.
Page 29
Treatment with siE2F1 decreases expression of E2F1 and DDB2 compared with
treatment with the control siRNA siGLO.
Figure 6 : ChIP assay for E2F binding on DDB2 promoter
660
A : diagram showing a representation of the putative E2F site in mouse DDB2 5’UTR
together with the position of the amplification primers chosen. The nucleotides are
numbered relative to the first nucleotide of the initiation of translation (Met).
B : ChIP assay for E2F1-3. Total: total lysate before immunoprecipitation; No-Ab, nonantibody control; E2F1, E2F2, E2F3 using anti-E2F1-3 antibodies -VE, negative PCR
control.
E2F1 and E2F3 antibodies immunoprecipitate a DNA fragment which is amplified with
the primers specific for a putative binding site in DDB2 5’untranslated region at the
expected size.
670
Page 30