Supplementary Information—Materials and Methods
Electroporation and gal positive/negative selection
To prepare electrocompetent bacteria, 500 μl of an overnight culture of E. coli SW102/YEbac102
was diluted in 12.5 μg/ml chloramphenicol containing LB medium (25 ml) in a 50-ml conical flask
and grown at 32°C. When the optical density at 600 nm reached 0.6, 10 ml of the culture was
transferred to another 50-ml conical flask and heat shocked at 42°C in a shaking water bath for 15
min. The culture was then briefly cooled on ice, transferred into two 15-ml tubes, and pelleted for 5
min at 5,000 g and 0°C. The supernatant was removed, and the pellet was resuspended in 1 ml icecold H2O by gently swirling the tube on ice. Then, 9 ml of ice-cold H2O was added, and the cells
were pelleted again; this step was repeated once more. After the second washing and centrifugation
step, the supernatant was removed, and the pellet (approximately 80 μl) was kept on ice until
electroporated with PCR product (targeting cassettes, see below). In the first step (gal selection), a
PCR product that contained the E. coli gal gene flanked by 50 nucleotides of sequence homology
to either side of the targeting locus on the virus genome (ICP6) was electroporated into 40 μl of
electrocompetent E. coli SW102/YEbac102 cells in a 0.1-cm cuvette (Bio-Rad, Hercules, CA) at
25 μF, 1.75 kV, and 200 ohms. After electroporation, the bacteria were grown in 1 ml LB medium
for 1 h at 32°C and then washed twice with 1 × M9 salts (37 mM Na2HPO4, 22 mM KH2PO4, 19
mM NaCl) as follows: the culture was pelleted at 11,000 g for 15 sec, resuspended in 1 × M9 salts,
and pelleted again. The washing step was repeated once more. After the second wash, the
supernatant was removed and the pellet was resuspended in 1 × M9 salts before 100 μl aliquots of
serial dilutions (1:10, 1:100, and 1:1,000) were plated on galactose minimal medium plates
supplemented with 12.5 μg/ml chloramphenicol to select Gal+ recombinant colonies. After 3 days
of incubation at 32°C, colonies were picked and streaked on MacConkey + galactose +
chloramphenicol indicator plates (Warming et al., 2005) to obtain single bright pink/red Gal+
colonies. One of these colonies was picked to prepare electrocompetent bacteria for the second
recombination step, the in-frame introduction of cell cycle-regulatory elements into ICP6 locus and
gal counterselection. For this, electrocompetent E. coli SW102 cells containing the gal-modified
YEbac102 were prepared as described above and electroporated with PCR products (targeting
cassettes; see below) containing coding sequences of cell cycle-regulatory elements flanked by 70
nucleotides of sequence homology to either side of the targeting locus on the viral genome (ICP6).
After electroporation, the bacteria were recovered in 10 ml LB medium for 4.5 h at 32°C and
washed twice with 1 × M9 salts, and serial dilutions were plated on minimal medium plates
containing glycerol as carbon source, leucine, biotin, and 2-deoxygalactose (DOG; Sigma-Aldrich)
for selection against gal. After 3 days of incubation at 32°C, colonies were picked, screened by
colony PCR for the presence of luciferase gene (5’-GGAACAATTGCTTTTACAGATGCAC-3’
and 5’-CACTGCATACGACGATTCTGTG-3’). BAC DNA from potential clones were isolated
and characterized by restriction endonuclease.
PCR amplification and purification of targeting cassettes
Phusion polymerase (Finnzymes, Espoo, Finland) was used to generate all the targeting cassettes
by PCR amplification. For gal selection, pgal plasmid (Warming et al., 2005) was used as a
template for gal targeting cassette. The following primers were used to amplify the targeting
cassette: forward: 5’- CCCGCCGACGTCCCCTCTCGAGCCCGCCGAAACCCGCCGCGTCTG
TTGAACCTGTTGACAATTAATCATCGGCA-3’ and reverse: 5’-GGGACGGCGACGACAGT
GGCGGCGGGCCTGGCGCGGAGGGGGTTTGTCGGTCAGCACTGTCCTGCTCCTT-3’. PCR
conditions were as follows: 30 sec at 98°C, and then 30 cycles of 98°C for 30 sec, 60°C for 1 min,
and 72°C for 1 min, followed by a final extension of 10 min at 72°C. For gal counterselection,
pC8-36 plasmid (Ho et al., 2004) was used as template for targeting cassette. The following
primers
were
used
to
amplify
the
targeting
cassettes:
forward:
5’-
CGACCCCACCACTCGCCGGACCCGCCGACGTCCCCTCTCGAGCCCGCCGAAACCCGCC
GCGTCTGTTGAATTGACATTGATTATTGACTAGTTATTAATAG-3’
and
reverse:
5’-
CCATGGCAGCGGGGGAGCGCGTGGGACGGCGACGACAGTGGCGGCGGGCCTGGCGCG
GAGGGGGTTTGTCGGTTACACGGCGATCTTTCCGCCCTTCTTG-3’. PCR conditions were
as follows: 30 sec at 98°C, and then 30 cycles of 98°C for 30 sec, 60°C for 1 min, and 72°C for 4
min, followed by a final extension of 10 min at 72°C. After completion of the reaction, DpnI (New
England Biolabs, Ipswich, MA) was added for digestion of the template for 1 h to remove any
plasmid template. The DpnI-digested reaction mix was heat inactivated and run on a 0.8% agarose
gel, and the PCR product was purified using a QIAQuick PCR purification kit (QIAGEN,
Valencia, CA) followed by ethanol precipitation. The DNA was resuspended in 30 μl H2O, and an
aliquot of 5 to 7 μl (200 to 300 ng) was used for electroporation.
Excision of BAC sequences and rescue of recombinant HSV-1 viruses
3 × 106 Vero cells per 10-cm tissue culture plate were co-transfected with 2 μg of plasmid p116,
which expresses Cre recombinase, and 6 μg of HSV BAC DNA using Lipofectamine (Invitrogen).
After 3 days of incubation at 37°C, the supernatant was harvested and the progeny virus was plaque
purified twice in Vero cells.
Southern blot analysis
HSV BAC DNA was prepared by using a plasmid purification kit (QIAGEN). Viral DNA were
extracted from purified virions with Proteinase K (200 μg/ml) and sodium dodecyl sulfate (SDS;
0.2%), followed by phenol-chloroform extraction. DNA were precipitated with ethanol and
resuspended in TE buffer (pH 8.0). 2 μg BAC DNA and 1 μg viral DNA were digested with
HindIII (New England Biolabs) and separated in 0.5% agarose gel. For Southern blot analysis,
DNA was transferred to a nylon membrane. An ICP6; luciferase and BAC-specific DNA
sequences were labeled by DIG labeling and detection system (Roche, Mannheim, Germany).
Virus propagation and titration
Wild type HSV-1 and the recombinant viruses were propagated in Vero cells by infection at low
MOI. When complete cytopathic effect occurred, the supernatant and cells were harvested and
exposed to three freeze-thaw cycles. The crude viral lysate was then purified by centrifugation
though a 25% sucrose gradient at 25,000 g for 1 h at 4°C in an SW28 rotor (Beckman Coulter,
Fullerton, CA). The resulting pellet was resuspended overnight in Hanks’ balanced salt solution
(HBSS; Invitrogen). The viral titers were determined in Vero cells by plaque assay according to
standard procedures. In brief, Vero cells (7 × 105) were seeded in 6-well plates. The following day,
they were infected with a serial dilution of viral stock in 0.5 ml of 10% FBS-containing DMEM.
The viruses were allowed to adsorb and infect for 2 h. Subsequently, the residual inoculum was
removed and the infected cells were overlaid with 2 ml of fresh tissue culture medium containing
1% of methylcellulose. After incubation for 3 days at 37oC, the monolayers were fixed with 1%
crystal violet. The plaques were counted and the viral titer was expressed as PFU/ml.
Real time quantitative PCR
For quantification of viral genome copy number, ΔGli36 cells were harvested as described in cell
cycle-regulation analysis. Whole cell DNA were extracted using the QIAamp DNA blood mini kit
(QIAGEN) and subjected to real time quantitative PCR analysis (15 min at 95°C and then 40
cycles of 15 sec at 94°C, 30 sec at 55°C and 30 sec at 72°C) using a Corbett Research Rotor-Gene
3000 system (Corbett, Sydney, Australia) and QuantiTect SYBR Green PCR Kit (QIAGEN). PCR
primers specific to the luciferase gene were used to quantitate the viral genome copy number of
(5’-GGAACAATTGCTTTTACAGATGCAC-3’
YE-PC8
and
5’-
CACTGCATACGACGATTCTGTG-3’). The luciferase copy number in each sample was
calculated from the standard curve generated with the luciferase containing pC8-36 plasmid DNA.
Each DNA sample was also analyzed for β-actin copy number following the same protocol using
primers
specific
for
β-actin
(5’-ATCCCCCAAAGTTCACAATG-3’
and
5’-
GTGGCTTTTAGGATGGCAAG-3’). The relative copy number of viral genome was calculated by
normalizing the copy number of luciferase with the copy number of β-actin.
Assay for luciferase activity
ΔGli36 cells were harvested as described in cell cycle-regulation analysis. Cell pellet was lysed
with protein lysis buffer (50 mM Tris, 10 mM EDTA, 150 mM NaCl, 0.1% SDS, 1% Triton X-100,
1 × protease inhibitor cocktail, pH 8.0) for 10 min on ice. Cell debris was discarded after
centrifugation at 14,000 g at 4°C for 10 min. 100 μl of the collected supernatant was subjected to
luciferase assay with an AutoLumat LB 9507 luminometer (Berthold Technologies, Bad Wildbad,
Germany). Two microliters of the supernatant was used to determine protein concentration, using
the Bio-Rad (Hercules, CA) protein assay dye reagent with an Ultrospec 3000 UV/visible
spectrophotometer (GE Healthcare Life Sciences, Uppsala, Sweden).
Immunocytochemistry
Primary human glioma cells are seeded on cover slip and fixed with 4% paraformaldehyde (SigmaAldrich) for 10 minutes at room temperature (RT) before blocking with 3% hydrogen peroxide to
remove endogenous peroxidase (BDH, Poole, UK). The cover slips were then incubated with either
mouse anti-human GFAP monoclonal antibody (Santa Cruz Biotechnology, Inc; 1:200) or Ki-67
(BD Transduction Laboratory; 5µg/ml) for overnight at 4°C in Triton X-100 containing PBS. Fixed
cells were subsequently rinsed with PBS three times (5 minutes interval) and incubated with either
goat anti-mouse polymer, followed by detection using 3, 3’ diaminobenzidine (DAB) substrate
solution (Dako) as described by the manufacturer. Similar concentration of rabbit IgG (Dako) or
mouse IgG1 (Dako) were used as negative control.
Immunofluorescence
Frozen sections of tumor tissues were air dried for 30 min and fixed in 100% acetone for 10min
twice with air drying in between incubation. The slides were washed twice in PBS and then
incubated with permeabilization buffer containing PBS with 0.05% Triton X-100 for 10 min at RT.
Blocking of sections was done in blocking buffer containing 1% BSA in PBS for 30min at RT. The
sections were then incubated with rabbit anti-gC polyclonal antibody (1:150 dilutions; R47
antibodies are kindly provided by Drs GH Cohen and RJ Eisenberg, University of Pennsylvania) at
4oC overnight, followed by repeated washing in PBS and then incubated in secondary antibody
conjugated to Alexa 647 (1:600 dilution, Invitrogen, Carlsbad, VA) in blocking buffer for 30min at
37oC. After the slides were counterstained with DAPI, they were observed under Nikon Eclipse 90i
fluorescent microscope. Images were captured with 10 ×/NA 0.45 Plan Apochromat objectives and
using image acquisition software (NIS-elements AR 3.00).
Western blot analysis
ΔGli36 cells (2 × 105) were seeded in 6-well plates. The next day, cells were incubated in DMEM
containing 10% FBS or DMEM containing 50 μM lovastatin and 0.5% FBS. After 40 h, the cells
were infected with YE-PC8 viruses, at an MOI of 2, respectively. After 1 h absorption, cells were
washed with cold PBS and incubated in DMEM containing 10% FBS, or DMEM containing 50 μM
lovastatin and 0.5% FBS, respectively. At 6 h after infection, cells were harvested and total
proteins were extracted. Protein samples were separated on 6% SDS-PAGE, transferred unto
polyvinylidene difluoride membrane (Millipore) and analyzed by Western blotting using primary
antibodies, mouse anti-Ki67 (1:250 dilution, DAKO) and rabbit anti-cyclin A (1:500 dilution,
Santa Cruz). Pan-actin (1:20 000 dilution, Neomarker) served as loading control.