2005-02-0142D, page 1
Supplementary Information, Full-version of Methods
Pseudoscorpions
Pseudoscorpions were laboratory-reared F2 and F3 descendents of 82 field-inseminated C.
scorpioides females collected in Panamá from 12 decaying Ficus spp. trees. After birth,
nymphs were reared individually to ensure virginity17. To generate full-sibling families,
F1 females were randomly mated to a single, unrelated male, and their progeny reared to
adults. These F2 individuals were either used in Block 1 of the experiment or were mated
to provide F3 individuals for Block 2.
Polyandry and inbreeding experiment
Within blocks, a completely randomized mating design was used to maximize sample
size. Before the experiment, each male was mated once to a non-experimental female.
Each mating pair was placed in a 28-mm-diameter arena, interactions were videotaped
for 30 min17, and the pseudoscorpions were then returned to their vials. After 48 h,
females were presented with the same male (N treatment) or a different male (NN, NS,
SN and SS treatments). Only females that unambiguously accepted a sperm packet in
both matings were retained for subsequent monitoring (n = 41 for the N treatment; 39 for
NN; 39 for NS; 36 for SN, and 44 for SS).
2005-02-0142D, page 2
Monitoring female reproductive success
Females were maintained in 32-ml transparent vials containing Ficus frass, were fed 8-10
Tribolium confusum larvae per week, and were checked every 3-4 days, increasing to
daily during late stages of gestation. During gestation, females remain in a silken nest
constructed on the vial wall, enabling monitoring of brood development with minimal
disturbance17. After a 14-day developmental period, nymphs are born simultaneously and
remain in the nest for 2-3 days. Within 24 h of birth, nymphs were counted and NS and
SN nymphs frozen for paternity testing. Females were assigned a RS score of 0, if they
aborted their entire first brood. Females not producing a brood sac within 45 days (n =
11) were excluded from the RS analyses, since such females never become gravid17.
Statistical analyses were conducted, using SAS26. Cephalothorax length (CL), the
trait most strongly correlated with female lifetime RS17, was used to control for body size
in the ANCOVA analysis of female RS (see text). For analysis of the entire data set, a
non-parametric ANCOVA was performed on rank-transformed RS data and residuals
were found to be normally distributed (Shapiro-Wilk test, W = 0.989, P = 0.157). For the
analysis excluding cases of spontaneous abortion, data transformation was not required
(W = 0.990, P = 0.403)
Minisatellite paternity assignment
PCR amplification of alleles at the cCscMS23 minisatellite locus (heterozygosity =
0.99)19 was used to assign paternity for 465 nymphs from 16 replications of each of the
2005-02-0142D, page 3
NS and SN treatments. DNA was extracted, as described elsewhere19. For each
replication, PCR products from the mother, the two putative sires and 8 to 20 offspring
were run on a 1.5% agarose gel and stained with ethidium bromide to visualize alleles.
Paternity was assigned based on the presence of unique paternal alleles in offspring. Only
replications in which the putative sires shared no alleles were scored (32 of 34
replications tested).
Several measures were taken to ensure amplification of both alleles from
heterozygous individuals. First, a strict consensus primer pair (cCscMS23 2+:
CAGTGTTGCCGGGTGGATTATTAACC and cCscMS23 2-:
ATGGCGTGKGAAGCAGAGAACTCTAGG) was designed from a large sample of
cCscMS23 alleles (N = 22). Second, the high primer-pair Tm enabled a robust, two-step
PCR reaction, involving 32 iterations of the following cycle: 93°C for 50 s followed by
an 8 min annealing/extension step at 68°C. Finally, PCR was performed using a mixture
of DNA polymerases capable of amplifying high molecular weight alleles (to 22 kb) from
femptogram quantities of DNA (Expand Long Template PCR system, Roche Applied
Science). The relationship between female RS and proportion of nymphs sired by the
non-relative male (arcsin-transformed) was analyzed using both the cubic spline
method27, and the REG and ORTHOREG procedures in SAS26. Differential embryonic
survivorship was calculated by comparing the mean number of nymphs born to N and SS
females, excluding cases of spontaneous abortion (49.74 versus 38.91). To estimate
sibling-male fertilization success, the resulting 1.278 correction factor was applied to
sibling-male paternity in replications with mixed paternity.
2005-02-0142D, page 4
Quantifying the rescuing effect
For NS and SN replications in which paternity was assigned, focal (sibling) male RS was
calculated by multiplying number of nymphs born by the proportion of DNA-profiled
nymphs sired by that male. For remaining NS and SN replications, to simulate natural
variation in paternity, sibling male RS was estimated using paternity values obtained by
randomly sampling from a normal distribution with the empirically-determined mean (NS
= 0.66, SN = 0.60) and variance (NS = 0.10, SN = 0.20). For the SS treatment, since the
two brothers must, on average, share paternity equally, paternity values were obtained by
randomly sampling from a normal distribution with a mean of 0.50 and a pooled NS/SN
variance of 0.15.