1
Supporting Materials and Methods
CD11b+ Gr1+ Bone Marrow Cells Ameliorate Liver Fibrosis
by Producing Interleukin-10 in Mice
Yang-Gun Suh,1 Ja Kyung Kim,2 Jin-Seok Byun,1 Hyon-Seung Yi,1 Young-Sun Lee,1
Hyuk Soo Eun,1 So Yeon Kim,1 Kwang-Hyub Han,2 Kwan Sik Lee,2 Gregg Deuster,3
Scott L. Friedman,4 and Won-Il Jeong1
Materials. Carbon tetrachloride (CCl4), OptiPrep and type I Collagenase were
purchased from Sigma-Aldrich (St. Louis, MO). Percoll gradient and DNase I were
obtained from GE Healthcare (Buckinghamshire, UK) and Roche (Indianapolis, IN),
respectively. Human hepatic stellate cell lines (LX-2 and hTERT) were friendly
obtained from Dr. Friedman (Mount Sinai School of Medicine, NY, USA) and Dr.
Brenner (UC San Diego, CA, USA) respectively.
Serum chemistry. Serum alanine aminotransferase (ALT), aspartate aminotransferase
(AST), total cholesterol, triglyceride, and albumin were measured using VetTest
Chemistry analyzer (IDEXX Lab., Westbrook, ME) according to manufacturer’s
instruction.
Mouse BMC preparation and Isolation of liver MNC. For transfer of BMC, 6-weekold mice were sacrificed by CO2 inhalation, and bones of tibias and fibulas were
removed. The BMC were flushed from the medullary cavities of the excised bones,
and suspended in RPMI-1640 containing 10% FBS. For isolation of liver MNCs,
livers were removed and minced into small pieces, which were shaken in the
digestion buffer (0.075 % collagenase type I in HBSS with 0.02% DNase I) at 37°C
for 20 min, homogenized and filtered through a 70-μm cell strainer. For elimination of
hepatocytes, the cell suspension was centrifuged at 400 rpm for 5 min at room
temperature, and then supernatant was collected, washed in PBS and resuspended in a
40% Percoll gradient. The cell suspension was gently overlaid onto 70% Percoll and
2
centrifuged at 2,400 rpm for 30 min. Liver MNCs were collected from the interface.
Co-culturing experiments of activated HSCs and BMC. For isolation of HSCs,1
mouse livers were perfused in situ first with EGTA solution (5.4 mM KCl, 0.44 mM
KH2PO4, 140 mM NaCl, 0.34 mM Na2HPO4, 0.5 mM EGTA, 25 mM Tricine, pH
7.2), followed by the perfusion buffer and the digestion buffer (0.009% collagenase
type I in HBSS with 0.02% DNase I) at 37°C for 20-30 min. The cell suspension was
filtered through a 70-m cell strainer and centrifuged at 400 rpm for 5 min at room
temperature to remove hepatocytes. The supernatant was washed, resuspended in
HBSS, loaded on 11.5% OptiPrep and centrifuged at 1400 g for 15 min at 4°C. HSCs
were collected from interfaces and cultured in RPMI-1640 with 10% FBS and 10%
horse serum on plastic plates for 4 days to activate themselves spontaneously (D4
HSCs). For co-culturing experiments, D4 HSCs were fasted in RPMI-1640 with 1%
FBS for 6 hours and then co-cultured with BMC for 6, 12 or 24 hours. For
experiments of human samples, human hepatic stellate cell lines, LX-2 and hTERT
were maintained in DMEM with 10% FBS. After fasting in RPMI-1640 with 1% FBS
for 6 hours, LX-2 or hTERT cells were co-cultured with human BMC for 6, 12 or 24
hours.
Human BMC preparation and Procedure of BMC infusion. Human BMC were
isolated as described previously.2 Bone marrow (500-750 mL) was harvested from
both iliac bones as standard procedures under general anesthesia and was collected in
a plastic bag containing heparin.3 After removal of fat and bony particles by filtration,
MNCs of bone marrow were isolated using the automatic cell washer 2991 (Gambro,
Lakewood, CO). The final concentrated cells were made up to a final volume of about
100 mL.
Five-mL of the final cell product were subjected to trypan blue dye
exclusion test, bacterial culture, and cell counting. At 4-8 hours after the bone marrow
harvest, the final bone marrow MNC preparation was administered via peripheral vein
over an hour. BMC infusion is described in Supporting Fig.4E, F.
Fluorescence-activated cell sorting (FACS). Isolated liver MNCs or BMC were
stained with anti-CD45 (30-F11), anti-F4/80 (BM8), anti-FoxP3 (FJK-16s)
(eBioscience, San Diego, CA), anti-CD45.1 (A20), anti-CD11b (M1/70), anti-CD3e
3
(145-2C11), anti-NK1.1 (PK138), anti-CD4 (RM4-5), anti-Gr1 (RB6-8C5), anti-Ly6C
(AL-21), and anti-Ly6G (1A8) (BD bioscience, San Jose, CA). For blocking nonspecific antibody reactions, cells were pre-incubated with anti-mouse CD16/32 mouse
Fc blocker (BD bioscience) before the staining with antibodies. The stained cells were
analyzed using BD™ LSR II Flow Cytometer (BD bioscience) and FlowJo software
(Tree Star, Ashland, OR). For intracellular staining, PE conjugated anti-IL-10
antibody (BD) was used. In vitro experiment, GolgiStop protein transport inhibitor
(BD) containing monensin was treated to BMC after 6 hours of co-culturing with D4
HSCs as manufacturer’s instruction, and then the BMC were further cultured for 6
hours. The cultured BMC were permeabilized with Cytofix/Cytosperm solution (BD),
stained with PE conjugated anti-mouse IL-10, and subjected to FACS analysis. For ex
vivo experiment, freshly isolated BMC from each mouse were restimulated with 1 ml
of 25 ng/ml PMA, 500 ng/ml ionomycin, and GolgiStop for 6 hours, and then
subjected to FACS analysis by same methods with in vitro experiments. The sorting
of BMC was performed using FACSAria™ II Cell Sorter (BD bioscience) depending
on their marker expression.
Staining. Five-μm sections of paraffin embedded tissue blocks were stained with
0.1% Sirius Red (Sigma-Aldrich) to examine collagen deposition. For measuring of
collagen deposition, 9 areas of each section were taken and analyzed using an
Olympus BX51 microscope equipped with a CCD camera (Tokyo, Japan) and
computer-assisted image analysis with DP2-BSW (Olympus). Immunohistochemistry
and immunofluorescence staining were performed with anti-α-SMA antibody (Dako,
Glostrup, Denmark) and anti-F4/80 antibody (Novus Biologicals, Cambridge, UK).
The antigen-antibody complexes were visualized with avidin-biotin peroxidase
complex solution using an ABC kit (Vector Laboratories, Burlingame, CA) and DAB
(Invitrogen, Eugene, OR) or visualized with Alexa Fluor®594 conjugated anti-mouse
IgG or anti-rat IgG secondary antibody (Invitrogen) and VECTASHELD Mounting
Medium with DAPI (Vector Laboratories) as manufacturer’s instructions. For staining
intracellular IL-10 in the BMC, the BMC co-cultured with D4 HSCs for 12 hours with
GolgiStop and then the BMC were attached to slide glasses by cytospin with 500 rpm
for 5 minutes, fixed with 4% paraformaldehyde, permeabilized with 0.2% triton-X
(Sigma-aldrich), then stained with anti-mouse/rat IL-10 antibody (R&D Systems,
Minneapolis, MN), and visualized with ABC kit and DAB. Giemsa staining (Merck,
4
Damstadt, Germany) was performed in the BMC co-cultured with D4 HSCs or in the
BMC expressing IL-10 and CD45.1.
Immunoblot. Proteins from cells and tissues were extracted with RIPA buffer (30
mmol/L Tris, pH 7.5, 150 mmol/L sodium chloride, 1 mmol/L phenylmethylsulfonyl
fluoride, 1 mmol/L sodium orthovanadate, 1% Nonidet P-40, 10% glycerol, and
phosphatase and protease inhibitors) after homogenization of tissues. Western blot
analyses were performed with 50-80 μg proteins from liver homogenates using anti-αSMA and anti-β-actin antibodies (Sigma-Aldrich). Proteins were separated by
electrophoresis through 7.5-12.5% SDS-polyacrylamide gels and then transferred to
nitrocellulose membranes using ECL system (GE healthcare).
Quantitative RT-PCR. Total RNA from purified cells was extracted using Trizol
(Invitrogen). Extracted 1ug of RNA was reverse-transcribed using the SuperScript® II
reverse transcriptase (Invitrogen) and oligo(dT) primer to make cDNA. Synthesized
cDNA and gene specific primers (Supporting Table 2) were used for PCR using
amfiSure PCR master mix kit (GenDepot, Barker, TX). Quantitative RT-PCR was
performed with the CFX96 system (Bio-Rad, Hercules, CA) and the SYBR Green
supermix kit (Bio-Rad). Expression of specific genes was normalized and expressed
as a fold-change relative to housekeeping genes (-actin or GAPDH).
5
Supporting Table 1. Clinical characteristics of enrolled patients for autologous
bone marrow infusion.
Effective patients
Non-effective
All patients
(n = 10)
patients (n = 5)
(n = 15)
4:6
3:2
7:8
56 (6.6)
49 (5.8)
53 (7.0)
Hepatitis B virus
10
4
14
Alcohol
0
1
1
Child-Pugh score*
7.2 (0.4)
8.0 (0.7)
7.5 (0.7)
Albumin*, g/dL
2.9 (0.4)
2.9 (0.6)
2.9 (0.5)
Sex (M:F)
Age,
* years
Cause of liver cirrhosis
*Values are expressed as the mean (standard deviation).
6
Supporting Table 2. Primer sequences
Name
Forward primer
Reverse primer
Mouse IL-10
GCTCTTACTGACTGGCATGA
CGCAGCTCTAGGAGCATGTG
Mouse IL-6
TCCATCCAGTTGCCTTCTTG
TTCCAC GATTTCCCAGAGAAC
Mouse MCP-1
AGGTCCCTGTCATGCTTCTG
TCTGGACCCATTCCTTCTTG
Mouse FoxP3
GGCCCTTCTCCAGGACAGA
GCTGATCATGGCTGGGTTGT
Mouse ColIa1
CTGCTGGCAAAGATGGAGA
ACCAGGAAGACCCTGGAATC
Mouse α-SMA
CTGACAGAGGCACCACTGAA
GAAGGAATAGCCACGCTCAG
Mouse β-actin
AGAGGGAAATCGTGCGTGAC
CAATAGTGATGACCTGGCCGT
Mouse MMP-9
GTGTTCCCGTTCATCTTTGAGG
GAAACCCCACTTCTTGTCAGTG
Mouse MMP-13
TGTTTGCAGAGCACTACTTGAA
CAGTCACCTCTAAGCCAAAGAAA
Human IL-10
GAGATGCCTTCAGCAGAGTGAAGA
AGGCTTGGCAACCCAGGTAAC
Human GAPDH
CCACTCCTCCACCTTTGAC
ACCCTGTTGCTGTAGCCA
7
Supporting Figure Legends
Supporting Fig. 1. Infusion of BMCs ameliorates CCl4-induced liver fibrosis in mice.
Mice were injected with CCl4 three times a week for 2 weeks and then isolated whole
bone marrow cells (BMCs) of GFP+ mice were infused through tail vein. Mice were
sacrificed at 12 or 24 hours after infusion of BMCs. (A) Serum chemistry was
conducted for AST, triglyceride, cholesterol and glucose. (B) Stained area with Sirius
red and α-SMA were analyzed. (C) Isolated HSCs from mice livers were subjected to
RT-PCR analyses. (D) After staining with α-SMA antibody, frozen liver sections were
observed under the fluorescent microscopy (original magnification, upper panels
×100; lower panels ×400). Data are expressed as the mean ± SEM. *P < 0.05, **P <
0.01 in comparison with the corresponding controls.
Supporting Fig. 2. Infused BMC influence the frequencies of CD4+CD25+Foxp3+
Tregs and F4/80+CD11b+ macrophages but not in those of NK and granulocytic cells
in fibrotic liver. Mice with 2-week CCl4–induced liver fibrosis were sacrificed at 12
or 24 hours after infusion of BMC of GFP+ mice via tail vein and liver MNCs and
tissues were isolated or collected. (A) Liver MNCs were first gated with CD45+ cells
and then analyzed with gates of lymphocytes, monocytes and granulocytes. (B) Treg
in liver MNCs were analyzed by FACS using antibodies to CD4, CD25 and Foxp3
after infusion of BMC at 12 or 24 hours. (C) FACS analyses were performed using
antibodies to CD3, NK1.1, Gr1, F4/80 and CD11b. (D) Frozen liver tissues were
immunostained with F4/80 antibody and DAPI (original magnification, upper panels
400; lower panels ×800). (E) Frozen liver tissues were immunostained with F4/80
antibody at 24 hours after GFP+ BMC infusion (original magnification, ×800). Data
are expressed as the mean ± SEM *P < 0.05, **P < 0.01 in comparison with the
corresponding controls.
Supporting
Fig.
3.
Infused
BMC
subtypes
CD11b+Gr1+F4/80+
and
CD11b+Gr1highF4/80- play important roles in IL-10 production in fibrotic livers of
recipient mice. Mice with 2-week CCl4–induced liver fibrosis were sacrificed at 12 or
24 hours after infusion of BMC of GFP+ or CD45.1+ mice via tail vein. Liver MNCs
were isolated and subjected to FACS analyses. (A, B) The percentages of subsets of
8
GFP+ BMC at 12 and 24 hours after BMC infusion.
Supporting Fig. 4. Co-culturing BMC with HSCs. (A) Isolated HSCs from healthy
mice were cultured on plastic dish for 4 days (D4 HSCs). Then freshly isolated BMC
of mice were co-cultured with activated D4 HSCs (HSCs:BMC = 1:10). Co-cultured
BMC were quickly attached to D4 HSCs at early time point (5 min). (B) After coculturing, the adherent and floating BMC of mice were harvested and subjected to RTPCR. (C) Human HSCs (LX-2 and hTERT) were co-cultured with human BMC of
HBV patients for 6 hours after 6 hour-starvation of human HSCs (HSCs:BMC = 1:10).
(D) Depending on the improvement of Child-Pugh scoring and albumin levels,
patients (n=15) were divided into effective group (n=10) or non-effective group (n=5)
after autologous BMC infusion and then analyzed IL-10 levels in blood of noneffective group. (E) Schematic presentation of autologous bone marrow infusion
procedure. (F) Changes of serum albumin levels after 6 months of autologous BMC
infusion. Data are expressed as the mean ± SEM. *P < 0.05 in comparison with the
corresponding controls.
Supporting Fig. 5. Co-culturing BMC with D4 HSCs. Isolated HSCs from healthy
mice were cultured on plastic dish for 4 days (D4 HSCs). Then freshly isolated BMC
were co-cultured with activated D4 HSCs for 6 to 24 hours (HSCs:BMC=1:10). (A)
The frequencies of CD11b+Gr1highF4/80- and CD11b+Gr1+F4/80+ BMC were analyzed
by FACS. (B) After co-culturing BMC with D4 HSCs, IL-10 positive cells were
analyzed in the adherent and floating BMC. (C) IL-10 positive BMC were analyzed
using antibodies to IL-10, CD11b, Gr1 and F4/80. (D) IL-10+CD11b- BMC were
analyzed using antibodies to Gr1 and F4/80 but there were no significant differences
between both groups. (E) To define the features of CD11b+Gr1highF4/80- and
CD11b+Gr1+F4/80+ BMC, they were analyzed using additional antibodies to Ly6G
and Ly6C. CD11b+Gr1highF4/80- and CD11b+Gr1+F4/80+ BMC were identified as
CD11b+Ly6G+Ly6Clow and CD11b+Ly6G-Ly6Chigh cells, respectively. (F) As shown in
Fig. 5E, selected three populations of BMCs were sorted and defined morphologies
(original magnification, upper and middle panels ×400 and lower panel ×1200). Data
are expressed as the mean ± SEM. *P < 0.05, **P < 0.01 in comparison with the
corresponding controls.
9
Supporting Fig. 6. Infusion of WT BMC does not ameliorate liver fibrosis in
RALDH1-/- mice. RALDH1-/- mice with 2-weekCCl4-induced liver fibrosis were
infused with isolated whole BMC of WT mice through tail vein and then were
sacrificed at 24 h after infusion of BMC. (A) Representative α-SMA staining of liver
tissue (original magnification, ×100). (B) There were no significant changes in the
population of Gr1+CD11b+ and F4/80+CD11b+ cells in liver. (C) Intrahepatic
CD4+CD25+FoxP3+ Treg did not increase in RALDH1-/- mice after infusion of WT
BMC at 24 hours.
Supporting Fig. 7. Mice with 2-week CCl4-induced liver fibrosis were infused with
vehicle, or with isolated whole BMC of control WT or IL-10-/- mice through the tail
vein. Mice were sacrificed at 12 and 24 hours after BMC infusion. MMP-9 (A) and
MMP-13 (B) mRNA levels in liver MNCs were determined using qRT-PCR analyses.
Data are expressed as the mean ± SEM. *P < 0.05 in comparison with the
corresponding controls.
10
References
1.
Jeong WI, Park O, Radaeva S, Gao B. STAT1 inhibits liver fibrosis in mice by
inhibiting stellate cell proliferation and stimulating NK cell cytotoxicity. Hepatology
2006;44:1441-51.
2.
Kim JK, Park YN, Kim JS, Park MS, Paik YH, Seok JY, Chung YE, Kim HO, Kim KS,
Ahn SH, Kim do Y, Kim MJ, Lee KS, Chon CY, Kim SJ, Terai S, Sakaida I, Han KH.
Autologous bone marrow infusion activates the progenitor cell compartment in
patients with advanced liver cirrhosis. Cell transplantation 2010;19:1237-46.
3.
Schanz U, Gmur J. Rapid and automated processing of bone marrow grafts
without Ficoll density gradient for transplantation of cryopreserved autologous or
ABO-incompatible allogeneic bone marrow. Bone Marrow Transplant 1992;10:50713.