1. A scientific researcher is attempting to discover how keratin is produced in
humans. Keratin is an important protein that makes up your hair. Eventually, this
individual discovers the genes that contain the instructions for making this specific
protein. The scientist is also surprised because he constantly sees another molecule,
which his colleagues tell him is called mRNA. Explain why the scientist also sees
mRNA and how DNA ultimately contains the instructions for making protein.
2.Determine the amino acid sequence from the following DNA template strand
sequence:
3’ TACCCCGAATCCCGCCACACT 5’
3. Complete a venn diagram where you note the similarities and differences
between DNA and chromosomes. Also, make sure to use the following words: gene,
trait, characteristic.
4. A) Skin cells are constantly lost or die in a daily basis. Make a brief diagram that
shows what your body must do as a result.
B) Does a skin cell have the same DNA as a neuron (brain cell)? Do neurons and skin
cells use their DNA in the same way?
5. Explain how both of these processes help to produce sex cells that have unique
combinations of DNA.
6. Homer Simpson is exposed to radiation on a daily basis, which is known to mutate
or change DNA. (Remember- Homer works at a nuclear power plant). Professor
Frink analyzes Maggie’s DNA and notices that her DNA is heavily mutated. Explain
how this happened.
B = dominant allele, long tail in dogs
b = recessive allele, short tail in dogs
7. A) Using a Punnett square, cross a heterozygous dog for this trait with a dog that
is homozygous recessive. What are the chances of a dog that is homozygous
recessive?
B) What are the chances of a dog with a long tail?
8. Red-green colorblindness is an X- linked recessive trait.
C) Using a punnett square, cross a female carrier with an affected male that is redgreen colorblind. What is the probability of obtaining a female that will be
unaffected?
D) What is the probability of obtaining a male that is unaffected (does not have the
trair)?
9. The pedigree chart seen below is for red- green color blindness, which is an Xlinked recessive trait. Determine the genotype for all of the individuals below.
10. The pedigree chart seen below is for tay- sachs disease, which is an autosomal
recessive trait (not X- linked). Determine the genotype for all of the individuals
below. (Remember- individuals that are shaded in are homozygous recessive for
this trait)