The Mystery of John Wilkes
Booth
“I have too great a soul to die like a criminal.”
John Wilkes Booth
Abraham Lincoln (1809- 1865) and his wife Mary Todd Lincoln attended the play
Our American Cousin at Ford’s Theatre on April 14, 1865. The couple arrived late and
the Lincoln’s were accompanied by a Miss Harris and a Mr. Rathbone. The Lincoln’s box
was supposed to be guarded by a policeman by the name of John Frederick Parker, who
left during the intermission of the play to travel to a nearby tavern with Lincoln’s
footman and coachman. His travels left the President unattended, and it is unclear if
Parker returned after the attack on the President. During this gap in the protection
detail and at a point in the play where the audience would be laughing, actor and
confederate sympathizer, John Wilkes Booth entered the Lincoln’s sate box and shot
Lincoln in the back of the head. The assassination occurred five days after Robert E. Lee
surrendered to Ulysses S. Grant. This plot was carried out as a part of a large conspiracy
intended to rally the remaining Confederate troops to continue fighting.
This plan failed miserably. Within a half hour of his escape on horseback from
Ford’s Theatre, Booth rode over the Navy Yard Bridge and into Maryland.
THIS IS WHERE THE MYSTERY BEGINS
After retrieving supplies stored at Surrat’s tavern, Booth and one of his
conspirators traveled to the home of Dr. Samuel Mudd, a local doctor who determined
that Booth’s leg had been broken during his escape from the theatre. Mudd made a
splint for the broken leg and a pair of crutches for the assassin. For the next week Booth
hid in a local swamp until they could cross the Potomac River. On April 24 th, they
arrived at the farm of Richard Garret, a tobacco farmer. Booth or a Booth look alike,
remained with a co-conspirator William Herold, at the Garret barn until April 26 th, when
Union soldiers arrived at the farm. The following events are unclear…was it Booth who
was surrounded and killed by Union soldiers or was it an imposter? There is speculation
that Booth got away. David Herold allegedly told the Union soldiers that the man they
shot and killed was not John Wilkes Booth, but James W. Boyd, a captain in the
Confederate army. Three other eyewitnesses all described the dead man as having light,
1
reddish hair. Booth was known
to have jet-black hair. The
government moved the body to
a warship, the U.S.S, Montauk,
an iron-clad ‘Monitor’ type ship,
where the autopsy was
John Wilkes Booth
performed. No relatives or
Boyd
Boyd
friends who could identify Booth
were allowed to view the body. From there, the story gets even stranger.
James W. Boyd
Herold tells Union soldiers that the person killed was Captain James W. Boyd.
Boyd and Booth were similar in appearance, except that Boyd was a strawberry-blonde.
Boyd had been captured by the Union army earlier in the year and was being held at a
prisoner of war camp in South Carolina. But in February of 1865, he was transferred to a
location in Washington, DC, by direct order of none other than Edwin Stanton, Lincoln’s
Secretary of War. He later signed a loyalty oath to the Union, giving rise to the theory
that Stanton turned Boyd into a Union spy. Whatever the case, the paper trail on Boyd
ends in April of 1865.
Why would Stanton possibly use Boyd as a patsy? The aftermath of Lincoln’s
death was chaotic. Keep in mind, the Civil War had just ended days before the
assassination when General Lee surrendered. Many in the Confederacy, including its
president, Jefferson Davis, were still on the loose and vowing to keep the war going.
John Wilkes Booth became the focus of America’s first nation-wide man-hunt. For
twelve agonizing days, the country was in a state of shock over the assassination and
the wider conspiracy which was to include the murder of Vice President Andrew
Johnson and Secretary of State William Seward.
Investigators learn of two potential aliases that Booth
may have used to escape justice. One path leads them to follow
a John Byron Wilkes, an American who fled first to Europe, then
to India. The document trail for Wilkes is an interesting one, as
he allegedly returned to the United States in 1873 and was
photographed. The resemblance to Booth is striking, *IF* the
John B. Wilkes
John Wilkes Booth
picture is authentic! There is even a will left by ‘Wilkes’ where he
Boyd
Boyd
allegedly left all his property to Booth’s family. Unfortunately, the will is not signed, nor
its authenticity verifiable.
2
The second identity that Booth may have used is
that of John St. Helen. In 1872, John St. Helen apparently
got married in Franklin County, Tennessee. He had told
his wife about his true identity, and she insisted that
they remarry with him using his real name. There is
indeed a marriage certificate listing John W. Booth. The
marriage did not last long as St. Helen left Tennessee for
John Saint Helen
John Wilkes Booth
Texas, and later, to Enid, Oklahoma. John St. Helen
Boyd
Boyd
committed suicide in Enid in 1903, consuming arsenic. Combined with the embalming
fluids of the day, his corpse became mummified and was not buried. Instead, it bounced
around between various owners, including a traveling side show at one point. For some
50 years, people were able to view the body of the man who claimed to be the real John
Wilkes Booth.
Investigators concluded after their investigation that the only way to be certain
is for a modern DNA test to be performed. Several bone samples are being held at the
Walter Reed Army Hospital to this day. If DNA samples were compared with those of
Edwin Booth, his brother who is currently buried in Cambridge, Massachusetts, a
positive ID can finally be made. However, while Booth’s family and many historians
desire such testing, the courts have yet to allow for it.
Today, you will be investigating the remains of John Wilkes Booth and his
Brother Edwin Booth to determine if the remains buried as the assassin are that of John
Wilkes Booth or that of James W. Boyd.
The following activity is designed to demonstrate the techniques used by
molecular geneticists and forensic pathologists. Today you will perform an activity
known as DNA fingerprinting or electrophoresis. You have been provided with samples
of mitochondrial DNA sequences. These samples are designed to represent one-half of a
strand of replicated DNA. The base sequences found within these strands are unique to
you and your maternal relatives and can be used as a means to identify a person from a
sample of bodily fluid. With nuclear DNA, a child receives half of its DNA from each
parent in any give strand, half of the sequence will match the mother’s DNA and the
other half will match the father’s DNA. In the case of mitochondrial DNA, an exact copy
is inherited from your mother as it has been passed from all of the female relatives on
your mother’s side of the family.
3
During the actual process of electrophoresis, DNA is removed from a tissue
sample, (such as blood or hair). This DNA contains hundreds of copies of each DNA
strand. The DNA molecules, hundreds of thousands of bases long, are cut into smaller
pieces using several different restriction enzymes. These enzymes only cut the DNA
where specific sequences of bases occur. The result of the enzyme activity is a pool of
DNA fragments are sorted by size. This is accomplished by taking advantage of the
electrical charge on each one of the fragments. As and electric current is passed through
a semi-permeable agarose gel the various fragments are pulled through the gel at
different rates. The rate and distance migrated, depends on the charge and the length
of each of the pieces. The DNA is then treated so that the two strands come apart,
exposing single strands of DNA bases. The gel is then transferred to a thick sturdy piece
of paper. The paper is then soaked in a solution containing tiny single stranded DNA
fragments. These fragments are radioactive markers, called probes, which will attach to
complementary bases in the cut up DNA strands. The treated paper will allow the
probes to stick to the appropriate bases, and the remainder of the probes is washed
away. The piece of paper is then placed on X-ray film, and the film is developed. A dark
spot appears wherever a radioactive probe stuck to the DNA. The result is a unique
pattern of spots, called the DNA fingerprint. This fingerprint is unique to the individual,
and can be repeated with tissue samples from any bodily fluid, with the exception of red
blood cells, and achieve the same result. Why not red blood cells? Mature red blood
cells do not contain a nucleus, and as a result do not contain enough reliable DNA to
produce a true test. If red blood cells are the only source of DNA, the DNA must be
cloned using a process known as PCR (polymerase chain reaction) so that enough DNA is
present in order to get an accurate test. You will now use the materials provided to
simulate such a test.
For these tests scientists were able to obtain mitochondrial DNA samples from the
following people John Wilkes Booth, Edwin Booth, relatives of the real Booth’s mother
and the mother or John W. Boyd. Remember the concept of heteroplasmy, where a very
small portion of the mitochondrial DNA might be a contribution from the male parent.
This occurs only if the tail of the sperm enters the egg during the process of fertilization.
The head of the sperm is an empty vessel that contains the DNA of the male parent,
while the tail of the sperm must contain mitochondria to supply energy for the process
of locomotion.
In order to establish the claim that John Wilkes Booth survived the massacre at
Garret’s barn, the DNA from the buried body of the impostor, James W. Boyd’s
mitochondrial DNA must match his maternal relatives.
4
MATERIALS
1.
DNA sequence from James W. Boyd
2.
DNA sequence from maternal relative John Wilkes Booth’s Mother
3.
DNA sequence from male skeleton from grave believed to be Edwin Booth
4.
DNA sequence from relative of James W. Boyd
5.
DNA sequence standard to ensure the tests accuracy
Procedure:
1. Review your data table and you will see the labels that should be attached to
create 5 separate columns, as seen in the example below.
Maternal relative
James W. Boyd
Booth’s Mother
Edwin Booth
of James Boyd
STANDARD
MAKE SURE THAT YOU KEEP EACH PERSON’S DNA SEPARATE THROUGHOUT THIS
ACTIVITY.
2. To simulate the action of radioactive probes use a highlighter and cover the
letters CAT in each of your segments.
3. With your PENCIL you are going to simulate the action of a restriction enzyme.
Scan you DNA strips until you find the letters “GG CC”. MARK across the strip
between the letter G and C, you will be forming a fragment that ends with a GG
and another that begins with a CC.
(Each sample has 5 of these sites so after cutting you will have 6 pieces. The
standard contains 7 of these sites so you will have 8 fragments)
4. Count the number of bases in each fragment, (the number of letters). Match this
number to the numbers in the chart provided. Then draw a line in the box that
corresponds to the number of letters in that piece. Use your highlighter to mark
the position of each of the CAT sequences in each piece on the line that you have
drawn.
THIS IS AN EXAMPLE ONLY
James W. Boyd
20
18
16
6. Compare the DNA of Booth and Boyd to all of the possible relatives. To whom is
he related? How do you know? Are you sure?
5
(Use this space to write your essay response)
6
James W. Boyd
CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAG
GGGG
Booth’s Mother
CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATAGGCCGATACAGCCGATGGCCATATA
GGGGG
Edwin Booth
CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATAGGCCGATACAGCCGATGGCCATATA
GGGGG
Body Buried in Booth’s Grave
CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAG
GGGG
7
STANDARD
CCAAGACATTATGCAGATGGCCAATAGACATTACGGCCATACCAGAGGCCAACATGGCCAAACACACC
CATCAGGCCATGGCAGACAGGCCATACGG
8
James W. Boyd
Booth’s
Mother
Edwin Booth
Number of
Bases
From Longest to
Shortest
Number of
Bases
From Longest
to Shortest
Number of
Bases
From Longest
to Shortest
20
18
16
14
12
20
18
16
14
12
20
18
16
14
12
Body in John
Wilkes Booths
Grave
Number of
Bases
From Longest
to Shortest
20
18
16
14
12
Standard
Number of
Bases
From Longest
to Shortest
20
18
16
14
12
Overlap Chart Here
These numbers indicate the possible number of Base Pairs in each of the pieces of DNA that can occur after the action of restriction enzymes
9
James W. Boyd
10
9
8
6
Booth’s
Mother
10
9
8
6
Edwin Booth
10
9
8
6
Body in John
Wilkes Booths
Grave
10
9
8
6
Standard
10
9
8
6
Remember: This is a sequence of mitochondrial DNA. If the body buried in Booth’s grave is really John Wilkes Booth his
mitochondrial DNA will match Booth’s maternal relative. If he is an impostor his mitochondrial DNA will match the mitochondrial
DNA of James W. Boyd’s relatives
10
The Mysterious Case of Edgar Allan
Poe
On September 27, 1849, Poe left Richmond, Virginia, on his way
home to New York. He was apparently well when he left Richmond. He
had no known allergies, coronary artery disease, diabetes, or other
systemic illnesses, and was taking no medication. He had Cholera three
months before his current hospitalization. Records indicate that he had
abstained from alcohol for the 6 months prior to his hospitalization But for the period
between his departure from Richmond and his arrival in Baltimore, no reliable evidence exists
about Poe's whereabouts until on October 3, when he was found delirious on the streets of
Baltimore, outside Ryan's Tavern. He was found on a wooden plank that lay across two barrels
located outside He was wearing someone else’s clothes, having been robbed of his suit the day
before. First-hand accounts describe Poe's appearance as "repulsive", with unkempt hair, a
haggard, unwashed face and "lusterless and vacant" eyes. Finding him outside a bar in a
semiconscious state was not unusual he had a history of both alcohol and opiate abuse. He was
taken to Washington College hospital later renamed Church Hospital and his final four days
were described in the medical record as follows:












When Poe arrived at the hospital he was nonresponsive
He was admitted for observation
At 3 a.m. he regained consciousness. He began to perspire heavily, was delirious and
had tremors and visual hallucinations for the next 28 hours
On the third day he was calm, alert, and lucid. The tremors had disappeared.
When questioned, Poe said he had a headache, some abdominal discomfort, and felt
terrible in general
He was transferred from ICU to a ward room because his condition was vastly improved
Physicians attempted to treat him with alcohol to relieve what they perceived to be
alcohol withdrawal symptoms, but he refused to dink it.
He was hydrophobic and swallowed a little bit of water with great difficulty.
That evening Poe relapsed into a delirious state calling out for friends and family, and
he became violent
He was restrained and lapsed into a coma until his death
Poe died October 7, 1849, on the fourth day of his hospitalization. The Baltimore
Commissioner of Health recorded “congestion of the brain” as his cause of death.
There was no autopsy
11
Based upon the evidence, modern physicians have concluded a virus was the likely cause of
Poe’s death, and that he may have contracted Rabies from one of his many pets. There are
several causes of delirium that could be related to his abuse of alcohol, alcoholics commonly
develop Pellagra which is as a result of niacin deficiency. Symptoms of Pellagra include
dementia, diarrhea, skin irritations, eventually leading to death. These symptoms are not
indicated by the hospital records immediately prior to Poe’s death. It was also not unheard of
for people travelling on the east coast of the United States to become infected with Yellow
Fever during this time. Symptoms of Yellow Fever include severe muscle pain, nausea, and
vomiting. The disease has three distinct phases separated by periods of remission. Because of
the periods of acute illness followed by the periods of days of remission Yellow Fever can be
safely ruled ou as a cause of Poe’s death. The doctors theorize that Poe may have contracted
the virus from being bitten by one of his pets. He was known to have cats and other pets.
Although there is no account that Poe had been bitten by an animal people remembered being
bitten only in a small number of cases. In addition, people can have the infection with this virus
for up to a year without major symptoms.
There are many accounts in history that Poe had not been abusing drugs or alcohol for as
long as six months prior to his death. It is also usual for a patient to recover for a brief period
and then worsen and die. The symptoms described above are much more consistent with an
infection of the central nervous system, such as rabies rather than that of drug or alcohol
abuse. The average survival after the onset of the symptoms of this virus is four days – the
same number of days that Poe was hospitalized before his death.
In this lab, you will be performing the actual tests that a physician or other clinician
would use to test a person suspected of being infected with the Rabies virus. The first step is to
determine whether the patient actually has Rabies. This lab simulation uses a mock Direct
fluorescent antibody this is a laboratory test that uses antibodies tagged with fluorescent dye
that can be used to detect the presence of microorganisms. This method offers straightforward detection of antigens using fluorescently labeled antigen-specific antibodies. This test
is antigen specific and is commonly used to detect the presence of the Rabies virus in nervous
system tissues
In this test, an enzyme is conjugated to an antibody and reacts with a colorless substrate
to generate a colored reaction product. In this test an antibody specific for the nucleocapsid
protein of the Rabies virus is coated into the wells of a micro titer plate and is used to detect
the presence of the specific pathogen in the patient’s tissue sample. This is sometimes referred
to as a capture assay since the antibody coating the plate “captures” the virus, holds it in the
well, and allows it to be detected by a second antibody. For Rabies, nervous system tissue is
added to the well of the plate as a potential source of virus. The sample is allowed to react
12
with the antibody that is coating the well. The presence of the antigen-antibody complex in the
well is detected by adding an enzyme-conjugated secondary antibody, (tagged with a
fluorescent dye), which binds to the viral antigen. This creates a classic “sandwich” assay in
which the captured Rabies virus is trapped between two antibodies, the outermost of which is
conjugated to an enzyme. A substrate for the enzyme is then added. If the antigen (virus) has
been captured, the complex of antibody-antigen-enzyme conjugated antibody will catalyze a
glowing reaction and a positive test result is indicated.
Procedure Overview:
Step One: The dry well in a micro titer plate has been coated with the antibody (primary antibody)
for the nucleocapsid protein present for the Rabies virus.
Step Two: You will wash the entire plate with buffer solution and turn the plate upside down and
tap gently on stack of paper towels to dry the plate.
Step Three: You will add the labeled patient sample to this well. It will contain the Rabies virus if
the patient is currently infected. The virus will be present in the nervous system tissue and will bind
to the antibody (Y) coated on the plate. This captures the virus present in the patient’s sample.
Step Four: You will add the anti -Rabies antibody (λ, secondary antibody) that has been tagged with
a fluorescent dye. This antibody then combines with the captured virus from the patient’s sample.
This produces a sandwich complex with antibody on each side of a captured antigen.
Step Five: You will Shine a black-light or UV light on the micro titer plate to determine if the patient
has been infected with the Rabies virus. A positive test is indicated by a fluorescent glow in one or
more wells of the plate.
LAB PROCEDURE
Preparing your micro titer plate
Divide micro titer plate into 2 halves length wise, labeling rows by number 1-4. Then divide by
every 3 wells across, drawing a line. You will perform each test in triplicate to verify your
results.
13
1. Control +
2. Control –
3. Poe brain
tissue
4. Poe cord
Procedure
1. Add 2 drops per well of the primary antibody to all wells being used, use correctly
labeled pipet.
2. Incubate for 2 minutes at room temperature
3. Add 2 drops per well of the Control +, Control –, Poe brain, and Poe spinal cord tissue
using correctly labeled pipet.
4. Add 2 drops of buffer solution and incubate for 2 minutes . Now turn the plate upside
down and tap gently on stack of paper towels to dry the plate.
5. Add 2 drops per well of the secondary antibody to all wells being used with correctly
labeled pipet.
6. Incubate for 2 minutes at room temperature
7. Shine a black-light or UV light on the micro titer plate to determine if the patient has been
infected with the Rabies virus. A positive test is indicated by a fluorescent glow in one or
more wells of the plate.
8. Record results
14
If a person has a positive test for the presence of the Rabies virus then a second test is used to
confirm the diagnosis.
1. What is your diagnosis of this patient?
2. What evidence do you have to support your conclusion?
3. What evidence will be found in the collected samples that will confirm or dispute your
diagnosis?
4. How is the diagnosis and treatment of the case of Edgar Allan Poe different from
modern cases of this disease?
15