Chapter 8 and 9 Review Questions
1. Please state three reasons to develop Molecular Techniques.
2. Please state two methods by which one can isolate a gene of interest from
the genomic DNA (Please be as exact as possible in your statement). Which
one is more efficient? Please explain your answer.
3. Please define molecular cloning. Why is molecular cloning an important
molecular technique?
4. Why is a recombinant DNA molecule called by this term? What components
make up a recombinant DNA molecule? Where did each come from?
5. Please name one significant discovery that led to the ability to make
recombinant DNA molecules. Please explain why this discovery was critical.
6. What are cos sites? Which genomic DNA molecule are they found in? What
are their functions? Why did the discovery of these sites advance the study of
molecular biology?
7. Please explain how molecular biologists can create ends that are similar to
cos sites in any DNA molecule?
8. Please state two tools that allow the study of a single gene. Please explain
their function.
9. Please name and describe each possible class of restriction enzyme. Which
are most useful for molecular biologists? Please explain why in detail.
10. Please give the appropriate name for each restriction enzyme.
a. The second enzyme discovered from Haemophilus influenza (strain D)
b. The fifth enzyme discovered from E. coli (strain R)
c. First enzyme discovered from Bacillus amyloliquefaciens (strain H)
d. First enzyme discovered from Serratia marcescens
e. The first enzyme discovered from E. coli (Strain B)
f. The first enzyme discovered from B. globigii.
11. In the DNA molecule below, there are some BamHI sites, please box each
site, show its axis of symmetry and diagram the products. (Please note that I
have only given you a single strand of the sequence)
5’-PO4- CGA TGG GGA TCC CGT TGA GGG GGC CTG CAT CCC CGGATCC GGG TAC
CCT CGA-OH 3’
12. In the DNA molecule below, there are some SmaI sites, please box each site,
show its axis of symmetry and diagram the products. (Please note that I have
only given you a single strand of the sequence)
5’-PO4- CGATCGCCCGGGATGACGATGTGACGTCCCGGGTGCAGCCCCGGGATCGTAOH-3’
13. Please list all possible materials in order to make a recombinant plasmid
(Please do not forget your DNA, especially the source for your gene of
interest).
13. You have your gene of interest (the insert) cut with EcoRI. Additionally
you have your plasmid cut with EcoRI. You wish to make a recombinant
plasmid with these. Please draw the possible results.
14. Why are ligation reactions using DNA fragments with overhangs more
efficient than those with DNA fragments containing blunt ends?
15. What enzyme is necessary to allow for a successful ligation? What is the
role of this enzyme function in the ligation reaction? On a diagram of a
recombinant plasmid being produced, please note where this enzyme will
work.
16. Assume you have cut insert and vector. Please note the steps by which the
two will be ligated together. In your answer, please note which enzyme is
necessary for the process, and how many bonds it may produce or break.
17. Please draw a picture of a plasmid, and include all important components.
As part of your answer, please state the function of each.
18. How does one separate out individual recombinant plasmids (DNA
molecules) in a ligation reaction? Please explain how this process works.
19. How does one increase the amount of a specific individual recombinant
plasmid? Please explain how this works.
20. For the purposes of cloning your gene of interest, which method is best if
you are trying to obtain your gene from the genomic DNA? Why is this the
case?
21. Matching. Pls. describe the function of each of the reagents in a PCR
reaction.
a. The PCR buffer
b. Taq. DNA polymerase
c. Forward Primer
d. Reverse Primer
e. Nucleotides
22. Please explain briefly the function of a PCR reaction.
22. Please discuss how a primer must be designed if you wish to amplify a
gene of interest for cloning purposes.
23. How many cycles of PCR must it take to create double stranded restriction
sites at the end of your amplified gene. Please explain your answer.
24. Please list each step in a PCR reaction and what its purpose is.
25. What is the purpose of doing a southern blot? Explain how the blot is
probed for these fragments?
26. Please compare and contrast both the goals and procedures behind a
northern and a southern blot.
27. How many primers are placed in a sequencing reaction? Why is this the
case?
28. Please name the two types of nucleotides that are present in the
sequencing reaction and describe the differences between each. Which one of
these nucleotides is not found in a PCR reaction, and why is this nucleotide
necessary?
29. What is the purpose of doing a DNA sequencing experiment?
30. Below is a sequencing gel. Pls. determine the sequence of the DNA
molecule using this gel. Please note that the dideoxy-Guanosine has a red
fluorescent tag, the dideoxy-Cytosine has a black fluorescent tag, the dideoxyadenine has a blue fluorescent tag and the dideoxy-thymine has a green
fluorescent tag.
31. When doing SDS-PAGE, why is it important to use the SDS (Sodium Dodecyl
Sulfate). Is SDS important for transferring proteins to a nitrocellulose
membrane for Western Blotting? Why?
32. When using SDS-PAGE write two methods by which proteins can be
visualized. Give a description how each technique works (for the western
blot-you do not need to discuss how the antibodies are made). For each
method, note for each one advantage it has over the other.
33. Please state the general paradigm behind blotting procedures and name
three blotting procedures. For each blotting procedure, state how it fits the
general paradigm.
34. You are interested in characterizing the expression of gene 1. Which
technique do you think would be best to use? Please explain why you chose
this technique in as much detail as possible?
35. When probing a western blot, how many different types of antibodies are
necessary. For each, please state its function.