Using Synthetic Biology and pClone Red for Authentic Research on Promoter Function:
Genetics (analyzing mutant promoters)
Todd T. Eckdahl and A. Malcolm Campbell
Genetics Promoter Mutation Quiz
Name:
Due in Lab XX/XX/XXXX
Below is the sequence of a promoter called Ptac that functions in E. coli. The start site for
transcription (+1) is the underlined A.
GAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAAT
1. Find the six-base -35 and -10 regions in the Ptac promoter and rewrite their sequence
below.
-35 sequence =
-10 sequence =
2. What are the functions of the -35 and -10 Regions? What do you expect would be the
effect on transcription of mutations in either or both of the -35 and -10 Regions of the Ptac
promoter?
-35 function =
-10 function =
3. DNA can be mutated in any of several ways. A single base can be changed (point mutation),
or one or more bases can be removed (deletion mutation) or added (insertion mutation).
Suggest two specific mutations of the Ptac promoter that could help us to understand how it
functions. Indicate the mutations on the Ptac sequence.