Protocol: PCR amplification of fungal 18S and bacterial 16S rDNA using degenerate primers.
Overview: Ribosomal RNA is frequently used to in the analysis of phylogenetic relationships among
species. Ribosomal RNA genes (rDNA) from species of unknown identity can be used to place them
phylogenetically by comparison with rDNAs in the extant databases. We amplify rDNA from bacteria
(16S rDNA) and fungi (18S rDNA) from genomic DNA templates using PCR. For filamentous fungi, we
found that it is essential to use genomic DNA obtained via lyophilization/grinding followed by
phenol/chloroform extraction (see accompanying protocol) to avoid contamination with secondary
metabolites that inhibit DNA polymerases. So far, we have had success in extracting DNA from bacterial
species and from yeast using the CTAB method and/or 5 Prime Archivepure DNA extraction kits,
respectively. Fungal and bacterial degenerate primers are used, allowing for application of similar but
not identical rDNA. The forward and reverse primers used in our study are:
univ fungal 0817-59 (TTAGCATGGAATAATRRAATA)
univ fungal 1196-39 (TCTGGACCTGGTGAGTTTCC)
univ fungal 1536-39 (ATTGCAATGCYCTATCCCCA)
univ bacterial 27f-Bif (AGGGTTCGATTCTGGCTCAG)
univ bacterial 27f-YM (AGAGTTTGATYMTGGCTCAG)
univ bacterial 27f-CM (AGAGTTTGATCMTGGCTCAG)
univ bacterial 27f-Chl (AGAATTTGATCTTGGTTCAG)
univ bacterial 27f-Bor (AGAGTTTGATCCTGGCTTAG)
univ bacterial 1492r (TACCTTGTTACGACTT)
Primers that efficiently amplify the ribosomal genes from each isolate must be determined one by one
on a trial-and-error basis. PCR is performed using the high-fidelity Pfx polymerase to reduce the
possibility of base misincorporation during extension.
It is essential to perform PCR under the most stringently clean conditions possible with clean reagents
and equipment to avoid contamination. We perform our reactions in a DNA-free biosafety cabinet, and
we use filter tips for EVERY procedure in our lab, PCR and otherwise, to avoid contaminating pipettor
barrels. Including negative controls (master mix with no template added) ensures that the process has
been carried out in a contaminant-free manner. Since fungi and bacteria are ubiquitous in dust, the
accidental amplification of rDNA from a contaminant is not difficult. However, we are accustomed to
performing this type of stringent amplification in our lab.
After the PCR is performed, the pipeline continues as follows: PCR products are separated by agarose
gel electrophoresis, excised, and purified away from the agarose using the Qiagen Gel Extraction (or
comparable) kit. Purified PCR fragments are then cloned into the pJET1.2 cloning vector, and
transformed into E. coli TOP10 cells*. Plasmids are extracted from the TOP10 cells via commercially
available plasmid purification kits (any are acceptable). Once the plasmids are in E. coli they can be
produced and extracted en masse as necessary (e.g. for sequencing).
*Invitrogen’s TOPO TA kit is commonly used for this purpose, but we and our colleagues have found the
TOPO kits to have an unacceptably high failure rate due to lack of incorporation of the topoisomerase
into the vector during manufacture, as evidenced by the detection of ~200 bp inserts that do not cause
cell death via the ccd gene product, upon colony screening.
Materials: For a PCR of 8 reactions (always make an extra reaction or two in case of pipetting error)
10
1
PCR tubes
Microcentrifuge tube
Ice bucket
P10, P20, P200, and P1000 automatic
pipettors and filter tips
dNTPs
Platinum Pfx DNA polymerase, buffer,
and enhancer solutions (Invitrogen)
Primers (forward AND reverse)
MgSO4
BSA (bovine serum albumin)
Template (gDNA extracts)
H2O (ultrapure, sterile)
Vortexer
Thermocycler
Agarose & ethidium bromide
Loading buffer (recipe below)
TAE buffer (recipe below)
Agarose gel extraction kit (any brand)
Master Mix (MM):
Initial
Concentrations
10x Buffer
10x Enhancer
10mM dNTPs
BSA (1 mg/mL)
50mM MgSO4
Primer (10 uM)
Forward
Reverse
Pfx (2.5 U/uL)
Template DNA
H20
Final
concentrations
2x
1x
0.3mM
0.1 mg/mL
1.0mM
Final vol/25uL Rxn
5 uL
2.5 uL
0.75 uL
2.5 uL
0.5 uL
MM vol for 10 Rxn
50 uL
25 uL
7.5 uL
25 uL
5 uL
0.2mM
0.2mM
0.5U
N/A
N/A
0.5 uL
0.5 uL
0.2 uL
2 uL
10.55 uL
5 uL
5 uL
2 uL
N/A
105.5 uL
Thermal Cycler Conditions:
(The conditions below are used for amplification using the primers univ fungal 0817-59
(TTAGCATGGAATAATRRAATA) and univ fungal 1536-39 (ATTGCAATGCYCTATCCCCA). The annealing
temperature and extension time will change with each new primer set.)
Initial denaturation: 94oC for 4 min
Denaturation: 94oC for 30 sec
Annealing: 50oC for 30 sec
Extension: 68oC for 1 min
Final extension: 68oC for 7 min
Hold: 8oC forever
X 40 cycles
(Remember to include a positive control and a negative, no-template control in every experiment.)
Protocol:
1.
2.
Program thermal cycler conditions and start preheating hot top and block.
In a sterilized biosafety cabinet in which the UV light has been on for >2 hours to degrade any
contaminating DNA that could serve as a contaminating template, place ice bucket containing
reagents, vortexer, pipettors and tips, microcentrifuge tube, and pre-marked PCR tubes.
a. Sterile water, MgSO4, and buffers can thaw at RT but dNTPs must thaw ON ICE.
b. After thawing, keep ALL REAGENTS and ALL PCR TUBES on ice at ALL TIMES. This
prevents mis-priming and the formation of erroneous PCR products.
c. Polymerase should not be taken out of freezer till you are ready to add it to the final
master mix. Take out, place on ice, aliquot, and replace immediately in freezer.
3.
4.
Add water to Eppendorf tube used to mix master mix (MM).
Vortex (to mix aqueous and heavier salt layers that form upon thawing) and add proper
amounts of buffer, enhancer, dNTPs, BSA, MgSO4 , and primers to MM tube.
Add PFX to MM.
Aliquot 23uL of MM into each of the 8 labeled PCR tubes.
5.
6.
7.
8.
9.
Add 2 uL template DNA to each PCR tube. Replace template DNA with water for negative
control. Flick to mix and spin briefly or tap on counter to get reaction into bottom of tube.
Ensure PCR tubes are securely shut and place into thermal cycler.
Run thermal cycler program.
Agarose Gel Electrophoresis
Make a 1.5% (w/v) agarose gel using TAE buffer (recipe below) and ethidium bromide (1 ug/mL final
concentration in gel). Use combs with the largest teeth possible to facilitate subsequent band-cutting
and gel extraction. Mix samples with loading buffer (recipe below). Run at ~85V for good band
separation. Include a 100 bp ladder. Visualize on long-wave UV light (to avoid destruction of DNA in
rDNA amplification products) and image.
Agarose Gel Extraction
Excise bands using a spatula. Work quickly because UV light degrades DNA. Purify using a gel-extraction
kit (any brand is acceptable. Resuspend or elute DNA in ultrapure water that has been brought to pH
8.0*. This will facilitate subsequent ligation reactions (EDTA in TE Buffer will inhibit ligase). For best
results, clone immediately into pJET1.2 as PCR product ends can fray upon freeze/thaw. Store purified
PCR product at -20oC.
*You can check the concentration of your purified bands using the NanoDrop spectrophotometer at this
point, but often, residual traces of gel extraction buffers and/or silica fragments from the DNA-binding
cartridge absorb strongly at 260 nm and will inhibit your ability to accurately quantify DNA.
6X Gel-Loading buffer
Ingredient
Amount
Concentration (final)
2.5% (w/v) bromophenol blue (stock)
2.5% (w/v) xylene cyanol FF (stock)
Sucrose (dry powder)
Total volume
1 mL
1 mL
4g
10 mL
0.25% (w/v)
0.25% (w/v)
40% (w/v)
Measure out all ingredients into a 14 mL conical tube and add sterile ultrapure water to bring to a final
volume of 10 mLs. Use the gradations on the conical tube to measure the final volume. Vortex well to
mix. The bromophenol blue and xylene cyanol dye are used for sample visualization as you load your
wells in the agarose gel, and for estimation of run progress during electrophoresis. Store in 1 mL
aliquots at 4oC. Use 5 µl of Gel Loading Dye, Blue (6X) per 25 µl reaction, or 10 µl per 50 µl reaction. Mix
well before loading gel.
Tris-acetate-EDTA running buffer, pH 8.18-8.29 (50X TAE)
Ingredient
Amount
Tris base
Glacial acetic acid
0.5 M EDTA (pH 8.0)
Total volume
242 g
57.1 mL
100 mL
1000 mL
Molarity in a 1X solution
40 mM
20 mM
1 mM
-----
Bring final volume to 1 liter. This stock solution can be diluted 50:1 with water to make a 1X working
solution. This 1X solution will contain 40mM Tris, 20mM acetic acid, and 1mM EDTA.