Supplemental Experimental Procedures
Genotyping
Genomic DNA was isolated from portions of mouse livers (100 mg) by phenol extraction. The
aqueous phase obtained after phenol extraction was re-extracted twice with chloroform (1:1,
v/v). Nucleic acids were precipitated with 0.1 volume 3 M sodium acetate plus 2.5 volumes
ethanol at -20oC overnight, collected by centrifugation (13200 g, 30 min, 4oC), air-dried,
dissolved in 50 µL deionized water, and quantified at 260 nm using NanoDrop.
DNA was genotyped by PCR using the Blmh intron 2 forward primer p1
(CACTGTAGCTGTACTCACAC), Blmh exon 3 reverse primer p2 (GCGACAGAGTACCATGTAGG) and
neomycin cassette reverse primer p3 (ATTTGTCACGTCCTGCACGACG) as described by Schwartz
et al. (Schwartz, Homanics et al. 1999). Briefly, the 10 μL PCR mixture contained 100 ng purified
mouse DNA, 5µl PCR MasterMix (Fermentas), 0.5 μL primer p1, p2, p3, 0.5 units of Taq
polymerase (Fermentas) and water to 10 μL. The thermal cycling reaction was run for 34 cycles
of 92°C for 30 s, 65°C for 40 s and 72°C for 90 s. The 0.7 kb amplicon from the Blmh wild-type
allele (obtained with p1, p2 primers) and the 0.95 kb amplicon from the Blmh-null allele
(obtained with p1, p3 primers) were distinguished on a 1.5% agarose gel stained with SYBRSafe
(Invitrogen).
Proteomic analyses
Sample preparation
Liver proteins were extracted using the phenol extraction method that allows efficient protein
recovery and removes non-protein components (Faurobert, Pelpoir et al. 2007). The liver was
disintegrated by grinding with dry ice using a mortar and a pestle. A 100 mg portion of the pulverized
liver material was extracted with 0.9 mL of extraction buffer (0.5 M Tris-HCl pH 7.5, 50mM EDTA, 0.1 M
KCl, 0.7 M sucrose, 2% w/v DTT) containing protease inhibitors (Protease Inhibitor Mix, GE Healthcare)
and 1 mL phenol containing 0.1 % hydroxyquinoline with vigorous shaking (10 min, 4°C). (The remaining
portion of the ground liver was saved and stored at -80°C.) The mixture was centrifuged (12 000 g, 10
min, 4°C), the phenol layer collected, and extracted again with an equal volume of the extraction buffer.
The phenol layer was separated by centrifugation, collected, and the proteins precipitated with 5
volumes of 0.1 M ammonium acetate in methanol (-80°C, 2 days). The protein pellet was collected by
centrifugation (12 000 x g, 10 min, 4°C), washed 3 times with 0.1 M ammonium acetate in methanol,
followed by 5-min washes with 80% and 100% acetone, and allowed to dry in the air.
Liver protein samples were dissolved in IEF rehydration buffer (7 M urea, 2 M thiourea, 2%
CHAPS, 55 mM DTT, 0.5% v/v ampholite pH 4-7, GE Healthcare). Insoluble material was removed by
centrifugation (16 000 g, 20 min). Protein concentration was determined using a commercial 2-D Quant
kit (GE Healthcare).
Two-dimensional IEF/SDS-PAGE
Protein separations and image analysis were carried out as described in ref. (Luczak,
Formanowicz et al. 2011). IPG strips (11 cm, pH 4-7, GE Healthcare) were rehydrated overnight in IEF
buffer containing liver protein samples, 0.3 mg/strip. The strips were subjected to IEF on IPGphor III
apparatus (GE Healthcare) using a ramping voltage (50 - 6000 V) to final 25 000 Vh. After IEF, IPG strips
were incubated for 15 min in an equilibration buffer (6 M urea, 2% w/v SDS, 30% v/v glycerol, 50 mM
Tris/HCl pH 8.8) containing 1% w/v DTT during the first equilibration step and 2.5% iodoacetamide w/v
during the second equilibration step. The second dimension was carried out using 11% polyacrylamide
gels (24 x 24 cm) on an Ettan DALT six system (GE Healthcare) according to the manufacturer's
instructions. For each sample, a 2D analysis was repeated three times. After electrophoresis, gels were
stained with Blue Silver overnight (Candiano, Bruschi et al. 2004) and scanned using an Umax scanner
and LabScan software (GE Healthcare).
The images were analyzed using the Image Master Platinum software version 7.0 (GE
Healthcare). Spots were detected automatically without filtering. Gel patterns were automatically
matched between groups. In addition, all individual matched spots were validated manually to ensure
the correctness of spot matching. For each identified protein, the relative abundance (% volume) was
calculated from its area and intensity divided by the total volume of all protein spots on a gel (Luczak,
Kazmierczak et al. 2012). This procedure corrects for small variations between individual gels due to
protein loading and staining.
Reproducibility of the IEF/SDS-PAGE analyses
For each studied animal in each experimental group IEF/SDS-PAGE analyses and % volume
measurements for the differentially expressed proteins were repeated 2-4 times. The variations in 5
volume were from 4.5±1.5% (for Ddah1) to for 8.6±2.7% (for Gamt).
Mass spectrometry
Protein spots were manually excised from gels using Pasteur pipets, transferred to Eppendorf
tubes, de-stained by series of washes with 50 mM ammonium bicarbonate, 25 mM ammonium
bicarbonate + 50% acetonitrile, and dehydrated with neat acetonitrile according to a procedure
described in ref. (Shevchenko and Shevchenko 2001). The dried gel pieces were digested with 10µl 20
ng/µl trypsin (Promega), 25 mM ammonium bicarbonate (37oC, 16 h). Tryptic peptides were recovered
from gel pieces by adding acetonitrile (to 10%), sonication in an ultrasound bath for 5 min, followed by
0.5 h incubation at 4°C.
The proteins were identified using an Autoflex MALDI-TOF (Bruker Daltonics, Germany) mass
spectrometer operated in reflector mode and using delayed ion extraction as described in ref. (Luczak,
Formanowicz et al. 2011). Positively charged ions in the m/z range 820-3500 were analyzed. 0.5 μl of the
sample was co-crystallized with a CHCA matrix and spotted directly on MALDI AnchorChip 600 nm target
(Bruker Daltonics). For data validation, external calibration was performed with a standard mixture of
peptides with masses from 700 to 3500 Da (Peptide Calibration Standards 1 – Bruker). Flex control v 2.0
was used for the acquisition of spectra and all further data processing was carried out using Flex analysis
v 2.0. Monoisotopic peptide masses were assigned and used for databases search. The proteins were
identified by peptide mass fingerprinting using the Mascot (Matrix Science, London, UK) program
against UniProtKB/Swiss-Prot database. The protein search was done using the following search
parameters: mass tolerance +/-0.2 Da, one allowed missed cleavage, cysteine treated with
iodoacetamide to form carbamidomethyl-cysteine and methionine in the oxidized form.
Western blotting
Liver protein extracts for Western blotting were prepared using a FastPrep24 apparatus (MP
Biomedicals). Portions of livers (200 mg) were homogenized at 4°C with 400 µL 0.1 M K-HEPES buffer,
pH 7.4, 2mM CaCl2, 1mM DTT, and protease inhibitor cocktail in Lysing Matrics M tubes (shaker speed 6
m/s, 40 s). The extract was clarified by centrifugation (14 000 g, 4°C, 15 min), the supernatant collected,
and protein concentration quantified using the Bradford assay (Bio-Rad).
Extracts containing identical amount of protein (10 μg) were added to the sample buffer (125
mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol), denatured (100°C, 5 min), and
subjected to SDS-PAGE on gels (10 x 10 cm, 12 %, Bis-Tris NuPAGE, Invitrogen). The separated proteins
were transferred to a PVDF membrane using ECL Semi-dry Blotter TE 77 (GE Healthcare) (60V, 1 h). The
PVDF membrane was blocked with 4% BSA in PBS, 0.1% Tween-20 and the blots were incubated
overnight with anti-ApoA1, anti-ferritin light chain, or anti-actin primary antibody (all from Santa Cruz
Biotechnology). Anti-mouse IgG conjugated to horseradish peroxidase (Sigma) was used as a
secondary antibody. After washing away the excess of the secondary antibody, the membrane
was incubated with ChemiFast Chemiluminescence Substrate (2 min in the dark; Syngene) and
the resulting chemiluminescent bands recorded using Gbox-Chemi apparatus (Syngen).
Glod4 mRNA analysis
Total RNA was isolated from approximately 30 mg C57BL/6J Blmh–/–or Blmh+/+ mouse
liver tissue using Total RNA Purification Kit (Novazym) following the manufacture’s protocol.
RNA was transcribed by oligo(dT)23, Anchored (Sigma) to cDNA according to the
manufacturer’s instructions (Enhanced Avian Reverse Transcriptase, Sigma) and a reverse
transcription reaction (20 µL) was carried at 45oC for 50 min. A 2 µL aliquot from the RT
reaction was used for PCR amplification (in 50 µL reaction mixture) with AccuTaqTM LA DNA
polymerase (Sigma) and one of pairs of primers complementary to each of three mouse Glod4
mRNA isoforms (Suppl. Table 1) (http://www.uniprot.org/uniprot/Q9CPV4). The PCR
parameters were as follows: 94oC, 2.5 min; 10 cycles of (94oC for 30 s; 53oC for 30 s and 68oC
for 60 s) and 20 cycles of (94oC for 30 s, 66oC for 30 s and 68oC for 60 s). Products of the RT–PCR
were analyzed by agarose gel electrophoresis. Experiment was repeated three times using
different individual Blmh–/– mouse liver tissue.
Suppl. Table1. Sequences of primers used in Glod4 mRNA amplification.
Glod4 isoform
1, 2
1, 3
2
3
Primer name
Glod4-1_fw
Glod4-1_rev
Glod4-2_rev
Glod4-3_fw
Primer sequence (5’3’)
GGGGTACCATCGAAGGTCGTATGGCCACTCGTCGAGCT
AACTGCAGCTAACCCGAAGCCTTTGGTT
AACTGCAGTCAGCCAGGATTTGCTGTC
GGGGTACCATCGAAGGTCGTATGATCTGTGGCTCTGTTCT
Supplementary references
Candiano, G., M. Bruschi, L. Musante, L. Santucci, G. M. Ghiggeri, B. Carnemolla, P. Orecchia, L. Zardi and
P. G. Righetti (2004). "Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome
analysis." Electrophoresis 25(9): 1327-1333.
Faurobert, M., E. Pelpoir and J. Chaib (2007). "Phenol extraction of proteins for proteomic studies of
recalcitrant plant tissues." Methods Mol Biol 355: 9-14.
Luczak, M., D. Formanowicz, E. Pawliczak, M. Wanic-Kossowska, A. Wykretowicz and M. Figlerowicz
(2011). "Chronic kidney disease-related atherosclerosis - proteomic studies of blood plasma." Proteome
Sci 9: 25.
Luczak, M., M. Kazmierczak, L. Handschuh, K. Lewandowski, M. Komarnicki and M. Figlerowicz (2012).
"Comparative proteome analysis of acute myeloid leukemia with and without maturation." J Proteomics
75(18): 5734-5748.
Schwartz, D. R., G. E. Homanics, D. G. Hoyt, E. Klein, J. Abernethy and J. S. Lazo (1999). "The neutral
cysteine protease bleomycin hydrolase is essential for epidermal integrity and bleomycin resistance."
Proc Natl Acad Sci U S A 96(8): 4680-4685.
Shevchenko, A. and A. Shevchenko (2001). "Evaluation of the efficiency of in-gel digestion of proteins by
peptide isotopic labeling and MALDI mass spectrometry." Anal Biochem 296(2): 279-283.