TABLE S1 NAME SET1 OLIGONUCLEOTIDE SEQUENCES atggagctttcttaccagactctca (F) tacagactcaaacttctcttgccag (R) PURPOSE OR CONSTRUCT SET2 cgcccgggaatggagctttcttaccagact (F) gcctcgagttatacagactcaaacttctcttgcc (R) For cloning of full-length Katnal2-S1 and L1 into vectors pGEX-4T-1 and pSVmyc1.0 (Santama et al., 1998) as an XmaI (SmaI)/XhoI in-frame fragment (Fig. 2, Fig. S8). SET3 cgctcgagcatggagctttcttaccagactctcaaac (F) cgggtaccttatacagactcaaacttctcttgccag (R) For cloning of full-length Katnal2-S1 and L1 into vectors pRSETB, and pEGFP-C2 as an XhoI/KpnI in-frame fragment (Fig. S8). SET4 cgcgcggccgccatggagctttcttaccagactc (F) gctctagattatacagactcaaacttctcttgccagg (R) For cloning of full-length Katnal2-S1 and L1 into vector pFLAG-CMV-2 as a NotI/XbaI in-frame fragment. Katnal2 cDNAs were excised as HindIII/Smal fragments for subsequent in-frame subcloning into vector mCherry-C3 (Fig. S8 and Fig. 7). SET5 tggtgagccgggacatttatc (F) cagtccagctcccatggca (R) For a diagnostic RT-RCR, resulting in a 508 bp product, common to all Katnal2 isoforms (Fig. 1C). SET6a ggacggcgagttcatctaca (F) ttgtacagctcgtccatgcc (R) For the amplification of a diagnostic product of 351 bp within the mCherry ORF (Fig. 7A) SET6b ggacggcgagttcatctaca (F) cgtctgagagcagtcctcgga (R) For the amplification of a diagnostic product of 560 bp (mCherryKATNAL-S1) and a product of 962 bp (mCherryKATNAL-L1). These products span the mCherry/ KATNAL2 junction in the fusion cDNA (Fig. 7A). SET7a catccgcaagcctgtgactg (F) ggcgctttcgtgcttccttg (R) For the amplification of a diagnostic fragment of 368 bp of mouse ribosomal protein L19 transcript, serving as a reference internal control and normalizing sample in RT-qPCR (Fig. 4A). SET7b tgaggtgtgcaccatgaac (F) cagaatgtgcttgccatagg (R) For the amplification of a diagnostic fragment of 187 bp of mouse pumilio homolog 1 transcript variant 2 (PUM1), serving as a second reference internal control and normalizing sample in RTqPCR (Fig. 4A). SET8a tggtgagccgggacatttatc (F) gcttctttgactagctgcttgg (R) SET8b cacaagaaggctacatggatgc (F) cctccacttcgtgacggtaaat (R) For the amplification of a diagnostic fragment of 91 bp, common to all katnal2 isoforms, by RT-qPCR, following shRNA-mediated silencing, in order to assess silencing efficiency (Fig. 4A). For the amplification of a diagnostic fragment of 207 bp, specific to the L-type katnal2 isoforms, by RT-qPCR, following shRNA-mediated silencing, in order to assess silencing efficiency (Fig. 4A). SET9 caaggctgttagagagataattgga (F) cgatctcggcgaacacc (R) For the amplification of the full-length ORF of mouse Katnal2 cDNAs and cloning into vectors pGEM-T easy or pCRII-TOPO (Fig. 1A). For the amplification of a 1272 bp product from the shRNA-bearing cassette in vector pLKO1 by PCR of genomic DNA for genotyping confirmation of shRNA-silenced clones 2.43 and 3.81.