Supplemental Material
1) Total RNA was extracted from the atypoid mygalomorph spiders Antrodiaetus riversi (O. P.Cambridge, 1883) and Megahexura fulva (Chamberlin, 1919). RNA was shipped to the Genomic
Services Lab at the HudsonAlpha Institute for Biotechnology (http://www.hudsonalpha.org/gsl/)
where non-normalized libraries were prepared using the Illumina TruSeq RNASeq kit, and
sequenced as 50-bp paired-end reads using Illumina HiSeq technology. Illumina sequences were
assembled de novo using Trinity software (Grabherr et al 2011). Assembled transcriptomes of
Antrodiaetus and Megahexura were combined, and in Geneious Pro (http://www.geneious.com/)
searched against a protein set of single copy, single exon genes (see Hedin et al 2012) derived
from the arachnid Ixodes scapularis. Proteins shared among these three taxa that also lacked
evidence for paralogy (i.e., only a single transcript in mygalomorph taxa), and showed
preliminary evidence for nucleotide divergence between Antrodiaetus and Megahexura, were
targeted for PCR primer design. Gene regions were further assayed for PCR primer success and
sequence variation on a small panel of A. thompsoni group genomics. Two gene regions showed
adequate variation in the A. thompsoni group and were pursued further:
Mid1-interacting protein, Ixodes gene ISCW001223, forward primer 5’GCAGCTATGTCGCACACGCAGGAACGC – 3’, reverse primer 5’ATGACAGAAAGTCAGCAGAATCTGCAAG – 3’.
Mid1 primers amplify gene regions in Aliatypus that BLAST to the Mid1-interacting protein in
Ixodes.
Methylmalonyl coenzyme A mutase, Ixodes gene ISCW020522, forward primer 5’ATGTAGGTATGGCTGGAGTTGCTGTAG – 3’, reverse primer 5’CAGCAGCCATGGCTTCTACAGTTGTCC – 3’.
MethylMal primers amplify gene regions in Aliatypus that do not in turn BLAST to the
MethylMal protein in Ixodes; this gene region was however retained as an anonymous nuclear
gene region for phylogenetic analysis (and is thus referred to as anonymous).
Both genes were PCR amplified using PlatinumTaq from Life Technologies, using a touchdown
PCR protocol as follows: 94C at 1 min, 60C at 1:15 min, 72C at 1:30 min (X10 cycles, dropping
annealing temperature -0.5C per cycle); 94C at 15 sec, 55C at 1:15 min, 72C at 1:30 min (X 30
cycles). PCR products were purified on Millipore plates, and sequenced in both directions using
Sanger technology at Macrogen USA (http://www.macrogenusa.net/).
2) Replicated subsampling for spedeSTEM was used for most OTUs; however, subsampling was
nonrandom with alleles selected based upon genetic distance (i.e., alleles that were most distantly
related within an OTU were chosen). A genetic distance matrix was estimated in PAUP*, with
subsampling as follows (provinces not mentioned were not subsampled). CR – both alleles were
sampled for RedHillRd (o) since it is heterozygous at EF-1γ nDNA and four alleles minimum are
required for spedeSTEM. TR – sampling followed n - 1 (with n being total number of alleles) for
each province, except San Gabriel (m) contained both alleles. SN – sampling followed n - 1,
although Piute (c) contained both alleles. In the combined analysis (all provinces), three alleles
were subsampled from each OTU, with the exception of south Coast Ranges, which contained
both alleles (2).
3) Probability of observing monophyly for Frazier and Sierra was calculated using equation 6 in
Roserberg (2007). Equation 6 sums the probabilities for at least that number of loci as
monophyletic (for example, if you specified four out of five loci as monophyletic, you would
also calculate for five out of five and sum the probabilities), but we calculated for the specific
number of observations of monophyly (i.e., only for four out of five loci). For both calculations,
we assumed 27 gene lineages within a locus, with equal sample sizes for all six loci. For Frazier,
the probability was calculated for five alleles as monophyletic, and 22 alleles outside of that
group. For Sierra, the probability was calculated for four alleles as monophyletic, with 23 alleles
outside of that group.
References:
Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L,
Raychowdhury R, Zeng Q, Chen Z, Mauceli E, Hacohen N, Gnirke A, Rhind N, di Palma F,
Birren BW, Nusbaum C, Lindblad-Toh K, Friedman N, Regev A. 2011. Full-length
transcriptome assembly from RNA-seq data without a reference genome. Nat Biotechnol.
15;29(7):644-52. doi: 10.1038/nbt.1883.
Hedin M, J Starrett, S Akhter, AL Schönhofer and JW Shultz. 2012. Phylogenomic resolution of
Paleozoic divergences in harvestmen (Arachnida, Opiliones) via analysis of next-generation
transcriptome data. PLoS ONE 7(8): e42888. doi:10.1371/journal.pone.0042888
Rosenberg N.A. 2007. Statistical tests for taxonomic distinctiveness from observations of
monophyly. Evolution. 61:317-323.