Supplementary Methods and References
Cancer tissue disaggregation and primary cell culture of rectal cancer stem cells
Cancer tissue collected from primary surgical specimens or mouse xenografts were
rinsed
three
times
with
phosphate
buffer
saline
(PBS)
added
in
5×
penicillin-streptomycin solution. The washed cancer tissue were minced with sterile
scissors into small (0.5-1mm3) fragments and resuspended in serum-free DMEM:F12
medium(HyClone, Logan, UT, USA) with 1 mg/ml Collagenase type IV(Sigma,
Louis, MO, USA),which
St.
incubated for 30-40 min at 37°C to obtain enzymatic
disaggregation. Cells were then resuspended by pipetting and serially filtered by using
sterile 70 μm nylon meshes. Contaminated blood cells were removed by incubation in
ammonium chrloride potassium phosphate hypotonic buffer for 6 min on 4°C. The
resulting cancer cells were cultured in a serum-free medium supplemented with 20
ng/ml EGF (Perprotech, Rocky Hill, NJ, US) and 10 ng/ml FGF-2 (Perprotech). The
tumor cells were subjected to DMEM medium (Hyclone) containing 20% FBS for
differentiation and the Caco-2 human colon cancer cell line was maintained in IMEM
Medium (Hyclone) supplemented with 20% fetal bovine serum (FBS; Hycolne), 100
units/ml penicillin and 100 mg/ml streptomycin in a humidified incubator under 95%
air and 5% CO2 at 37°C.
Immunohistochemistry, Immunofluorescent Assay and Immunobloting
Tumor specimens from mice or clinical patients were washed with 1×
phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde (Sigma), and
1
embedded in Parafilm. Sections (4 μm thick) were deparaffinized and rehydrated
before staining. Tissue antigens were retrieved by boiling in 10 mmol/L (pH 6.0)
citrate buffer (Sigma) or EDTA (ph 8.0) for 45 minutes. Sections were naturally
cooled down to room temperature before treating with 3% H2O2, and next samples
were hybridized with monoclonal antibodies CD44 (Abcam, Cambridge, MA, USA;
dilution 1:100) CD54 (Abcam, dilution 1:100), CDX2 (Abcam, dilution 1:200), CK7
(Abcam, dilution 1:200), CK20 (Abcam, dilution 1:200) and EGFR (Epitomics,
dilution 1:150) overnight at 4°C. Isotype IgG staining was used as a negative control
of immunohistochemistry experiments. Sections were then stained with 800× diluted
secondary antibodies (Santa Cruz, Heidelberg, Germany) for 1 hour at room
temperature.
Spheres were fixation with 4% paraformaldehyde (Sigma) for 30 minutes before
embedment in low melting point agarose for 1 hour at 4°C. The coagulated agarose
was embedded in Oct compound (Tissue Tek). For frozen section (4 μm thickness)
and differentiated cells were plated onto matrigel-coated glass coverslips for 1week
before fixation with 4% paraformaldehyde (Sigma) for 30 minutes at room
temperature followed by PBS washes. Cells were permeabilized with 0.1- 0.5% Triton
X-100/PBS for 10 minutes at room temperature, washed with 1× PBS, and blocked in
3% BSA 1 in PBS for 30 minutes before probing with CD44 Abcam, dilution 1:200,
CD54 (Abcam, dilution 1:200), CDX2 (Abcam, dilution 1:200), CK7 (Abcam,
dilution 1:200), CK20 (Abcam, dilution 1:200), E-cadherin (Abcam, dilution:1:200),
EpCAM (Abcam, dilution 1:100), fibronectin(Abcam, dilution:1:200), Vimentin
2
(Santa Cruz, dilution:1:200), α-SMA (Sigma, dilution:1:800) and Bmi1 (Epitomics,
dilution:1:200), Isotype IgG staining was used as a negative control of
Immunofluorescent experiments. primary antibodies overnight at 4°C, and followed
by the fluorescence-tagged mouse or rabbit secondary antibodies (dilution:1:800).
Fluorescence images were visualized with a fluorescence microscope (Zeiss Axio
scope A1) or confocol microscole (Nikon A1).
Immunoblotting was performed as described2 with the following primary
antibodies: Snail (Abcam,1:1000), slug (Abcam,1:1000),
E-cadherin (BD
Biosciences,1:1000), Vimentin (Santa Cruz Biotechnology, 1:1000),
(Themofish, 1:800) ,
Fibronectin
α-SMA (Sigma,1:5000), Lgr5 (Epitomics, Burlingame, CA,
USA, 1:800), Bmi1 (Epitomics,1:1000). Secondary antibodies were as follows:
goat anti-rabbit IgG-HRP ( Santa Cruz Biotechnology), goat anti-mouse IgG-HRP
(Santa Cruz Biotechnology).
DNA/RNA extraction and RT-PCR
Genomic DNA was isolated from spheroids followed by Neucleo Spin Tissue kit
(MACHEREY-NAGEL, Düren, Germany), The extracted DNA was also used for
PCR amplification of k-ras exon 2. PCR primers sets were designed using software
Primer ExpressTM (Applied Biosystem, Foster City, CA, USA) according to the
sequence deposited in GenBank (NC000012) for k-ras, k-ras primer sequence as
follows:
Forward:5’
CCTGCTGAAAATGACTGAATA
3’
and
reverse:
5’
CCTGCTGTGTCGAGAATAT 3’. PCR products were purified by the High pure PCR
product Purification Kit (Roche, Shanghai, China) and then analyzed for sequence
3
alterations by sequencing.
Total RNA of cells was extracted with Tripure reagent kit (Roche) according to the
manufacturer’s protocol. Subsequently, reverse-transcription of RNA and real time
PCR was performed using Takara RNA PCR kit. The primers was as described by
Medici D. et al.3 The target genes including E-cadherin, Fibronectin, vimentin, α-sma,
snail and slug genes were investigated by the manufacturer on an Bio-Rad CFX96
themal cycler (Bio-Rad, Hercules, CA, USA), with 40 cycles per sample. Cycling
temperatures were as follows:denaturing, 95°C; annealing, 60°C. The relative
quantitation of relative genes expression was calculated using the comparative Ct
method (2-△△Ct). Experimental target quantities were normalized to the endogenous
Human GAPDH control.
Migration assays in vitro
For transwell migration assays, 1 × 104 isolated tumor cells were plated in the
top chamber with the non-coated membrane (24-well insert, 8 μm pore size, Millipore,
Billerica, MA, USA). The cells were resuspended in 250μl of DMEM-F12 and placed
in the upper chamber, and medium supplemented with 10% FBS was used as a
chemo-attractant in the lower chamber. Cells were incubated for 24h and cells that did
not migrate or invade through the pores were removed by a cotton swab. Cells on the
lower surface of the membrane were stained and counted.
Supplementary References
4
1.
Ho Y, Gruhler A, Heilbut A, Bader GD, Moore L, Adams SL, et al. Systematic
identification of protein complexes in Saccharomyces cerevisiae by mass
spectrometry. Nature 2002, 415(6868): 180-183.
2.
Todaro M, Alea MP, Di Stefano AB, Cammareri P, Vermeulen L, Lovino F, et
al. Colon cancer stem cells dictate tumor growth and resist cell death by
production of interleukin-4. Cell Stem Cell 2007, 1(4): 389-402.
3.
Medici
D,
Hay
ED,
epithelial-mesenchymal
Olsen
transition
BR.
Snail
through
and
Slug
promote
beta-catenin-T-cell
factor-4-dependent expression of transforming growth factor-beta3. Mol Biol
Cell 2008, 19(11): 4875-4887.
5