DNA man
Loading sequences (proteins or DNA):
1. Multiple sequences:
A. Create and save notepad document with sequences in fasta format. Make a fictive
sequence between each. Make sure your sequences are numbered in sequential
order (1, 11, 12, … 19, ... 2, 22… 3 etc.).
For example:
>1_my_sequence_A
AGCTAGCTAGCTAGCTAGCTAGCT//
>1_fictive
AAAAAAA//
>11_my_sequence_B
AGCTAGCTAGCTAGCTAGCTAGCT//
B. Go to: sequence  load sequence  multiple and open saved notepad. Each
sequence should now be loaded into a separate channel. Note: if loading proteins,
DNAman will ask: “is this a DNA seq.”. For each answer “no”.
2. A few sequences:
A. Open new/existing document: Go to: file new/open
B. Copy fasta sequence from NCBI into new document (without sequence name).
C. Save file: Go to: file  save as "file name" (this will be the name of your sequence).
D. Choose channel to load the sequence then select the sequence and load:
Edit  Select all
Sequence  load seq  from selection
Saving nucleotide sequences:
1. Choose channel and go to: Sequence  display  DNA sequence
2. Go to: edit  Select all  change font size to 9.
3. Save file (see 2C).
4. You can also print your sequence
Saving amino acid sequences:
1. Generating amino acids: choose channel and go to: Protein  translation  one
letter (one letter represents aa), all frames (3), tick display with DNA sequence.
2. Save file (see2C)
3. Another alternative is to generate only one frame and request not to display the
DNA sequence. Then you can use the generated sequence to create a notepad
document with amino acid sequences, (as described above for nucleotide
sequences). This can be used for alignment.
Aligning nucleotide or amino acid sequences:
A. Load sequences as described above and go to:
Sequence  alignment  multiple seq. alignment
B. First remove any previously chosen channels and then add channels to align.
C. For nucleotides - choose type: DNA
D. For amino acids - choose type: protein
E. Press OK
Generating a restriction enzyme map:
Restriction  analysis  tick summary in text window, tick restriction on
sequence  next  select all enzymes  cutter all  end all  finish