Two missense mutations in melanocortin 1 receptor
(MC1R) are strongly associated with dark ventral coat color
in reindeer (Rangifer tarandus)
Dag I Våge1*, Mauri Nieminen2, David G Anderson3, Knut H. Røed4
1
Centre for Integrative Genetics (CIGENE), Dept. of Animal and Aquacultural Sciences
(IHA), Norwegian University of Life Sciences (UMB), PO Box 5003, N-1432 Ås, Norway
2
Finnish Game and Fisheries Research Institute, Reindeer Research Station, 99910
Kaamanen, Finland
3
School of Social Science, University of Aberdeen, Aberdeen AB24 4QY, Scotland
4
Department of Basic Sciences and Aquatic Medicine, The Norwegian School of Veterinary
Science, Post-box 8146 Dep., N-0033, Oslo, Norway
*
Corresponding author
Email addresses:
DIV: daginge.vage@umb.no
MN: mauri.nieminen@rktl.fi
DGA: david.anderson@abdn.ac.uk
KHR: knuth.roed@nvh.no
1
Abstract
Background: The protein coding region of melanocortin 1 receptor (MC1R) in reindeer
(Rangifer tarandus) was sequenced to identify potential variation affecting coat color. A total
of 129 animals were successfully sequenced, and high quality color photos were available for
a subset of 42 animals.
Results: Sequencing of the MC1R coding region revealed a T→C sequence variation at
nucleotide position 218 (c.218T>C) causing an amino acid (aa) change from Methionine to
Threonine at aa-position 73 (M73T). In addition, a T→G sequence variation was found at
nucleotide position 839 (c.839T>G), causing Phenylalanine to be exchanged by Cysteine at
aa-position 280 (F280C). The two sequence variants (c.218C and c.839G) were found to be
closely associated with a darker belly coat compared to animals not having any of these two
variants. All the 28 animals with clear white belly were homozygous c.218TT and c.839TT
and all 14 with a dark belly were carrying at least one of the alternative alleles (c.218C or
c.839G). It was not possible to see any systematic difference between those having the c.218C
compared to those having the c.839G, indicating a similarly mode of action.
Conclusion: We have identified two missense mutations in the MC1R gene that both show
strong association with a darkening of the otherwise distinct white ventral coat color in
reindeer. The amino acid change M73T affects the same position as the M73K previously
reported to give constitutive activation of MC1R in black sheep (Ovis aries), while the F280C
is identical to one of two variants previously reported to be associated with dark coat color in
Arctic fox (Alopex lagopus), supporting that the two variants found in reindeer are functional.
The complete absence of 73Thr and 280Cys among the 51 wild reindeer analyzed provides
some evidence that these variants are more common in the domestic herds.
2
Background
Wild living animals normally have a uniform phenotype, showing species specific coat color
and color patterns. In contrast, domestic animals show large variation in both colors and color
patterns. The reasons for this striking difference are debated, but it seems to be generally
accepted that human interference in the reproduction process has been a driving force behind
the large phenotypic variation in domestic animals [1-3]. On the other hand, there is some
experimental evidence showing that purifying selection is acting on coat color genes in wild
populations [1]. This can be attributed to negative pleiotropic effects of the coat color
mutations, or simply the direct effect of impaired camouflage caused by the change in coat
color.
Reindeer (Rangifer tarandus) are often not thought to be domesticated to the same extent as
other herd animals (eg. horses, cattle) due to the fact that they resist living in enclosures, often
forage for their own food, and sometimes intermix with still-extent wild populations.
Nevertheless, various grades of domesticated reindeer have been, and continue to be an
important resource to Arctic and Subarctic peoples across Eurasia who practice castration,
selective breeding, and use various techniques to isolate their animals from wild populations
[4-6]. While it is unknown for exactly what length of time domestication has been practiced
with Rangifer, most accounts locate the start of large scale ranching no earlier than 15th
century and speculate about the possible keeping of decoy or transport reindeer as far back as
the upper Pleistocene[5, 7].
The effects of controlled breeding is evident in the phenotypic variations, the timing of ruts
and breeding cycles, and a variety of color patterns in present day domestic populations which
differ from wild Rangifer [8]. Furthermore, indigenous herdsmen often distinguish domestic
Rangifer by sight and by behavior. In order better understand the time-depth of domestication
3
in different regions it would be useful to link specific genetic markers to coat color variations
so that archaeological faunal collections could be tested and thus identified as domestic or not.
The melanocortin 1 receptor (MC1R) plays a key role in regulating switch between
production of red/yellow pheomelanin and dark eumelanin in melanocytes [9], and mutations
in the MC1R gene has been found associated with coat color variation in a large number of
mammalian species [10-14]. In pigs, a strikingly different selection pressure on MC1R in wild
vs. domestic pigs was recently demonstrated [1]. When looking for genetic markers to be used
in differentiating between wild and semi-domesticated reindeer populations, we therefore
sequenced the reindeer MC1R in a population showing significant variation in coat color
patterns.
Results
The coding region of the reindeer MC1R consisted of 954 nucleotides (Accession no:
HG518556) that encoded a receptor of 317 amino acids. Alignment of the individual MC1R
sequences revealed a T→C sequence variation at nucleotide position 218 (c.218T>C) causing
an amino acid (aa) change from Methionine to Threonine at aa-position 73 (M73T). In
addition, a T→G sequence variation was found at nucleotide position 839 (c.839T>G),
causing Phenylalanine to be exchanged by Cysteine at aa-position 280 (F280C).
The two sequence variants were found to be closely associated (p<0.0001, Fisher’s exact test)
with a darker belly coat (Table 1). Photos showing the coat color phenotype were only
available from 42 animals with genotype information for both positions (Figure 1). The
animals were grouped according to either have a clear white belly color (28 animals), or
having a darker brown/grey belly color (14 animals). All 28 animals with clear white belly
4
were homozygous for the genotypes c.218TT and c.839TT. All the 14 animals with a darker
belly were carrying at least one of the alternative alleles (c.218C or c.839G). It was not
possible to see any systematic coat color difference between those having the c.218C
compared to those having the c.839G. Only one animal was homozygous c.218CC and one
animal was homozygous c.839GG. Both these animals had a generally dark appearance.
Among the total of 167 animals with known genotype the frequency of the variants c.218C
and c.839G was 0.04 and 0.10 respectively. These variants were not present among the 51
wild animals genotyped (Table 2).
Discussion
Based on studies in other species, the white belly in reindeer can most likely be attributed to a
high ventral specific expression of the agouti gene. A strict regional expression pattern has
been observed both in mammals [15] and in fish [16, 17]. The ventral expression of agouti
protein will induce a switch from production of black/brown eumelanin to red/yellow
pheomelanin in melanocytes by antagonizing the eumelanising effect of α-MSH on MC1R. In
addition, the agouti protein is also known to inhibit differentiation and proliferation of
melanoblasts and thereby diluting the yellow color to a more whitish appearance [8, 18].
There are several mammalian examples of MC1R mutations that give a constitutively active
receptor that makes the melanocytes constantly producing black/brown eumelanin, regardless
of the agouti protein is present or not [14, 19]. These mutations are normally inherited in a
dominant pattern, similar to what we observe in this study. A substitution similar to the M73T
has previously been reported in sheep [10], namely a Methionin to Lysine change in position
73 (M73K). Pharmacological studies of the sheep mutation showed that this change alone
5
activated the MC1R receptor to approximately 40% of maximal stimulation levels in the
absence of ligand. Although Threonine is different from Lysine, these results demonstrate that
a change from Methionine another amino acid in this position potentially can constitutively
activate the MC1R, which normally will increase the synthesis of dark eumelanin. A parallel
substitution (M71T) is also suspected to contribute to dark plumage color in chickens [20],
but since it appeared together with the E92K, which is a parallel to the dominant black color
allele (ESO-3J) in mouse, the functional effect of this mutation in chicken is not documented.
Also, a substitution identical to F280C has previously been found associated with dark coat
color in artic fox [11]. However, these dark foxes also carried a G5C substitution, so it could
not be firmly concluded which of these two substitutions that was the causative one.
However, it is worth noticing that both changes found in reindeer have parallels associated
with darker color in other animals. Since both the reindeer variants (M73T and F280C)
independently can give a darker belly in both the heterozygous and the homozygous state, it
seems reasonable to assume that both variants have the potential to constitutively activate the
MC1R. However, unlike the dominant black allele in sheep [10], the reindeer variants do not
color the animal completely black.
Interestingly, the reindeer variants are phenotypically most pronounced in the ventral area, a
region that also appears to be under special influence of the agouti antagonist, since the coat
color here is white instead of red/yellow. A similar pattern is observed in red foxes that are
heterozygous for the standard silver fox allele (a deleterious deletion in the agouti gene) [14].
While the wild type red fox has a nearly white belly, the heterozygote with a monoallelic
expression of the agouti protein has a nearly black belly, while the red parts of the animal is
still red. This could indicate that the agouti induced white areas are more sensitive to changes
in the agouti-MC1R interactions compare to other parts of the body.
6
Countershading, the change from a dark back to a white belly is a very common color pattern
in vertebrates, including fish. It is generally believed that this pattern is useful for avoiding
predation by compensating for the contrasts created by one’s own shadow. In a recent study
of ruminants, stronger countershading was found to be associated with open lighting
environments, living closer to equator and with small body size. Also, a distinct demarcation
between the dark dorsal side and the light ventral area were more common in open lighting
environments [21].
It is hard to predict how well these predictions will apply to reindeer which live for much of
the year on snow, and also subjected to the special conditions found at higher latitudes.
Nevertheless, one can imagine that depending on the habitat, some styles of countershading
could be beneficial in some conditions. For example, forest reindeer, found living in more
southerly locations, choose their feeding areas on the basis of snow depth and therefore could
benefit from a mottled color in forested environments. High Arctic tundra Rangifer, by
contrast, living for much of the year in open snow-covered environments would be expected
to avoid sharply contrasting coat colors.
The bioarchaeological literature, in general, does not grant one or another coat color a
selective advantage but instead associates any variety in coat color as a possible marker of
selection and reproductive isolation. Absence of any functional variation among the wild
reindeer analyzed provides some evidence that the variants identified in this study are more
common in the domestic herds. However, a larger selection of both wild and domestic
reindeer needs to be genotyped before it is possible to conclude whether the dark bellied
animals is a result of domestication, or that both phenotypes were present before any
domestication has taken place. In any case, M73 and F280 are both highly conserved across
distantly related vertebrates (Figure 2), indicating that the white bellied reindeers were present
before the dark bellied ones.
7
Conclusions
In the present study we have identified MC1R variants in reindeer that affects coat color. Two
nonsynonymous substitutions were found, one in amino acid position 73 (M73T) and one in
position 280 (F280C). Both variants are strongly associated with a dark belly coat color, a
region that otherwise is pure white. The phenotypic effect of each substitution seems to be
quite comparable. Based on the present results, it is not possible to firmly conclude whether
these variants can be used as markers of domestication. However, the strong conservation of
M73 and F280 across distantly related vertebrates indicates that this allele was present before
T73 and C280 appear.
Methods
Animals
DNA was isolated from blood or tissue samples from 133 semi-domestic reindeer obtained
from herds in Norway, Finland and Russia and from 51 wild reindeer from the
Hardangervidda and Rondane/Dovre herds in South-central Norway. One hundred of these
samples were obtained from the Kutuharju experimental reindeer research herd in Kaamanen,
Finland, among which a subset of 42 animals were individually photographed during winter,
28 with white belly and 14 with dark belly. A total of 129 animals were successfully
sequenced and genotyped, and 38 additional animals were only genotyped by the Sequenom
massARRAY platform in order to increase the number of wild reindeers with genotype
information.
8
PCR amplification and sequencing of GDF9
PCR - primers MC1-R1 (8023) and MC1-R2 (8024) (Klungland et al., 1999) were used for
amplifying the protein coding part of the reindeer MC1R gene. The amplified fragment of
1160 bp was directly sequenced with primers 8023 and 8024 (Table 3), using the BigDye
Terminator v3.1 kit (Applied Biosystems).
Genotyping of the c.218T>C and c.839T>G variants in reindeer MC1R
The Sequenom massARRAY platform (SEQUENOM, San Diego, USA) was used for
genotyping the c.218T>C and c.839T>G variants according to manufacturer’s
recommendations. Amplification primers and the extension primers are shown in Table 3. In
addition to the 38 wild reindeers only genotyped by this assay, the genotypes gained by
sequencing were also confirmed by this assay.
Sequence alignment
The software package, Phred-Phrap-Consed, was used for base-calling, quality assessment,
and sequence assembly of the MC1R sequence.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
9
DIV supervised the laboratory work including PCR amplification, DNA sequencing and
genotyping by Sequenon massARRAY platform. He also performed the sequence analysis
and wrote up the first draft of the manuscript. KHR initiated the study together with DIV.
KHR, DA and MN collected biological samples and MN obtained the phenotypic records
(pictures) from the animals. All authors contributed to the writing of the paper, and have read
and approved the final manuscript.
Acknowledgments
Liv Midthjell, Kjersti Kvie, Helene Meaas Svendsen, Kristil Kindem Sundsaasen and Ida
Johansson Schneider are acknowledged for excellent technical help. The fieldwork and
laboratory work for this article was supported by ERC Advanced Grant 295458 ‘Arctic
Domus’ held at the University of Aberdeen.
Figures
Figure 1 - Picture showing the two coat color phenotypes investigated in this study white belly and dark belly.
A: A typical white bellied individual. B: A typical dark bellied individual.
Figur 2 – Alignment of subregions of the MC1R in distantly related vertebrates.
10
Alignment of the reference protein sequences of reindeer, pig, dog, humans, mouse, sebrafish
and chicken.
Tables
Table 1 – Distribution of MC1R - genotypes among individuals with white and dark
belly.
Genotype c.218
Belly color
TT
White (28)
28
Dark (14)
TC
Genotype c.839
CC
TT
TG
GG
8
1
28
5
1
One animal was heterozygous at both positions, explaining why the “dark” genotypes did not
summarize to 14.
Table 2 – Distribution of MC1R - genotypes among all genotyped individuals.
Genotype c.218
Genotype c.839
TT
TC
CC
TT
TG
GG
Domestic reindeer
103
12
1
91
17
8
Wild reindeer
51
51
Table 3 – Primers used for amplification, sequencing and genotyping of the reindeer
MC1R gene.
11
Name
Direction
Position
Sequence5’-3’
8023
Forward
÷ 117 - ÷ 97a
CATGCCTGGGCCGACATTTGT
8024
Reverse
1024 - 1043a
CTCACCTTCAGGGATGGTCTA
C218F
Forward
191 - 210b
CCAAGAACAGCAACCTGCAC
C218R
Reverse
249 - 268b
TGACACTTACCAGCAGGTCG
C218E
Extension
201 - 217b
CAACCTGCACTCCCCCA
C839F
Forward
782 - 800b
TCTCGCTCATCGTCCTCTG
C839R
Reverse
846 - 865b
AAATGATGAGGGCCAGGAAG
C839E
Extension
821 - 838b
GCTGCATCTTCAAGAACT
a. Primer positions are numbered according to Klungland et al., 1999.
b. Primer positions are numbered according to the translation start codon.
References
1.
Fang M, Larson G, Ribeiro HS, Li N, Andersson L: Contrasting mode of evolution at a coat
color locus in wild and domestic pigs. PLoS genetics 2009, 5(1):e1000341.
2.
Linderholm A, Larson G: The role of humans in facilitating and sustaining coat colour
variation in domestic animals. Seminars in cell & developmental biology 2013, 24(6-7):587593.
12
3.
Reissmann M, Ludwig A: Pleiotropic effects of coat colour-associated mutations in humans,
mice and other mammals. Seminars in cell & developmental biology 2013, 24(6-7):576-586.
4.
Ingold T: Hunters, pastoralists and ranchers: reindeer economies and their transformations.
Cambridge: Cambridge University Press; 1980.
5.
David F, Enloe JG: L'exploitation des animaux sauvages de la fin du Paleolithique moyen au
Magdalenien. In: Exploitation des Animaux Sauvage a Travers le Temps. Juan-les-Pins:
Esitions APDCA; 1993: 29-47.
6.
Chesnokov V, David F, Diachenko VI, Karline C: Les Dolgans de la rivière Popigai (Taimyr de
l'est Russie), des nomades et des reinnes. Anthropozoologica 1996, 23:805-809.
7.
Aronsson KÅ: Forest reindeer herding A.D. 1-1800 an archaeological and palaeoecological
study in northern Sweden, vol. 10. Umeå: University of Umeå, Department of Archaeology;
1991.
8.
Guillot R, Ceinos RM, Cal R, Rotllant J, Cerda-Reverter JM: Transient ectopic overexpression
of agouti-signalling protein 1 (asip1) induces pigment anomalies in flatfish. PloS one 2012,
7(12):e48526.
9.
Cone RD, Lu D, Koppula S, Vage DI, Klungland H, Boston B, Chen W, Orth DN, Pouton C,
Kesterson RA: The melanocortin receptors: agonists, antagonists, and the hormonal control
of pigmentation. Recent progress in hormone research 1996, 51:287-317; discussion 318.
10.
Vage DI, Klungland H, Lu D, Cone RD: Molecular and pharmacological characterization of
dominant black coat color in sheep. Mammalian genome : official journal of the
International Mammalian Genome Society 1999, 10(1):39-43.
11.
Vage DI, Fuglei E, Snipstad K, Beheim J, Landsem VM, Klungland H: Two cysteine
substitutions in the MC1R generate the blue variant of the Arctic fox (Alopex lagopus) and
prevent expression of the white winter coat. Peptides 2005, 26(10):1814-1817.
12.
Klungland H, Vage DI, Gomez-Raya L, Adalsteinsson S, Lien S: The role of melanocytestimulating hormone (MSH) receptor in bovine coat color determination. Mammalian
13
genome : official journal of the International Mammalian Genome Society 1995, 6(9):636639.
13.
Marklund L, Moller MJ, Sandberg K, Andersson L: A missense mutation in the gene for
melanocyte-stimulating hormone receptor (MC1R) is associated with the chestnut coat
color in horses. Mammalian genome : official journal of the International Mammalian
Genome Society 1996, 7(12):895-899.
14.
Vage DI, Lu D, Klungland H, Lien S, Adalsteinsson S, Cone RD: A non-epistatic interaction of
agouti and extension in the fox, Vulpes vulpes. Nature genetics 1997, 15(3):311-315.
15.
Vrieling H, Duhl DM, Millar SE, Miller KA, Barsh GS: Differences in dorsal and ventral
pigmentation result from regional expression of the mouse agouti gene. Proceedings of the
National Academy of Sciences of the United States of America 1994, 91(12):5667-5671.
16.
Kurokawa T, Murashita K, Uji S: Characterization and tissue distribution of multiple agoutifamily genes in pufferfish, Takifugu rubripes. Peptides 2006, 27(12):3165-3175.
17.
Cerda-Reverter JM, Haitina T, Schioth HB, Peter RE: Gene structure of the goldfish agoutisignaling protein: a putative role in the dorsal-ventral pigment pattern of fish.
Endocrinology 2005, 146(3):1597-1610.
18.
Sviderskaya EV, Hill SP, Balachandar D, Barsh GS, Bennett DC: Agouti signaling protein and
other factors modulating differentiation and proliferation of immortal melanoblasts.
Developmental dynamics : an official publication of the American Association of Anatomists
2001, 221(4):373-379.
19.
Robbins LS, Nadeau JH, Johnson KR, Kelly MA, Roselli-Rehfuss L, Baack E, Mountjoy KG, Cone
RD: Pigmentation phenotypes of variant extension locus alleles result from point mutations
that alter MSH receptor function. Cell 1993, 72(6):827-834.
20.
Kerje S, Lind J, Schutz K, Jensen P, Andersson L: Melanocortin 1-receptor (MC1R) mutations
are associated with plumage colour in chicken. Animal genetics 2003, 34(4):241-248.
14
21.
Allen WL, Baddeley R, Cuthill IC, Scott-Samuel NE: A quantitative test of the predicted
relationship between countershading and lighting environment. The American naturalist
2012, 180(6):762-776.
15