Geneious DryLab
Martin Stervander & Maren Wellenreuther (modified by Staffan Bensch)
Preparations
Open Geneious as administrator (right-click program icon (in your start menu or on your desktop),
Run as administrator). When the program has opened, select Tools > Preferences >
General. You may now want to adjust how much RAM memory you allow Geneious. You can
probably allow it 60–75 % of your total RAM. (If you don’t know how much RAM you got, on a
Windows computer you can find out by opening the start menu, then right-click on Computer,and
select Properties.) Click Ok, and close Geneious, then open it again, for the memory settings to take
effect.
Choose Tools > Plugins. Here you can select from a bunch of (free) plugins. Please explore
them on your own! We will use a few of them, so install MAFFT multiple aligner, PhyML,
and MrBayes. Click Ok. The installations can run in the background while you work on the
exercises.
Before you start, make a Geneious folder under Local (in the folder tree) by right-clicking on Local
and selecting New Folder. Name it Workshop or something of your choice.
1
Exercises
Exercise 1: import/export files, trimming, alignment, and sequence
search.
This is a simple exercise to just deal with import/export, trimming, alignment, and sequence search.
Create a new Geneious folder in Geneious (under Local) by right-clicking on Local > New
Folder.
1. Import the sequence files in the (computer) folder Seq1-5 into Geneious by drag-anddropping. [It can also be done from Geneious by Edit > Import > From File or
Ctrl+I.] When/if asked whether to create a list or keep sequences
separate, choose separate.
2. Look at the five abi sequence traces with chromatograms, by highlighting or double-clicking
to open in a new window. The sequences look nice, but ends need trimming.
3. Identify the reverse primer HAEMR2 (GCATTATCTGGATGTGATAATGGT) by using the
alignment tool. Highlight one sequence and the primer sequence and execute “Pairwise
alignment”.
4. Make the sequence of the reverse primer annotated as a “primer”. Primer > Convert to
oligo. This will add the primer to your “primer database”.
5. Trim the ends by Annotate & Predict > Trim Ends [Right-click > Trim Ends].
You can do this for all the sequences in one go. Just mark the sequences. Select standard
settings (Annotate new trimmed regions rather than Remove), click Ok. Trimmed
regions will be annotated with the pink Trimmed annotation.
2
6. Check so that the reverse primer has been identified correctly
a. Selecting the pink Trimmed annotation by (one) clicking on it.
b. Hover with the mouse over the left end of the annotation until a double-ended
horizontal arrow turns up.
c. Click and drag the end, to extend the Trimmed annotation if you feel that more or
less bases should be trimmed.
7. (Possibly repeat for the 5’-end if you think more ambiguous peaks need to be trimmed out.)
8. Save the changes in the sequence by hitting Save or Ctrl+S.
9. This is good to know but skip this for now [If you have GenBank sequences you may want to
rename those in order not to only get GenBank accession numbers as leaves in a
phylogenetic tree
a. Select all GenBank sequences.
b. Edit > Batch Rename.
c. Replace the current name (Accession no) with for example Organism_Accession (see
screen shot). Click Ok. If satisfied with the preview, hit Ok.
10. Make an alignment by selecting all sequences and clicking Align/Assemble >
Multiple Align [Ctrl + Shift + A] and include the reference sequence
H_ACAGR2. Use the Geneious Alignment algorithm with standard settings.
11. Rename the alignment by selecting it and clicking again on the name (slow double-click) [or
hit F2]. Name it “ANYNAME1”.
12. Open the alignment (double-click) in a new window. This a protein coding genes so relative
the reference sequence, there should not be any gaps. Click “allow editing” and fix the gaps
by moving the whole alignment by the back spaces button using the consensus sequence.
Now when the sequences are aligned, you may also wish to edit the trimmed regions (there
might be more nucleotide positions with good data. Then save, and you will get this question
and answer (normally) yes.
3
13. Using your mouse and/or ShiftSelect the part of the alignment (with chromatogram) which is
not trimmed in any of the sequences. (Zoom in if you need.)
14. Click Extract > Extract region as alignment. Untick “Modify sequence
names…”.
15. Save the extraction as “ANYNAMEtrimmed”
16. BLAST the lab sequences directly from Geneious by selecting it and the hitting Sequence
Search.
17. Choose the nr database from GenBank, and restrict the number of hits (Maximum Hits)
to 5. Hit Search.
18. Your searches will turn up in a separate folder under Searches, in the Geneious folder
structure. (The BLAST’s against NCBI can be a bit slow!). What kind of organism have we
sequenced?
19. Open the alignment “ANYNAMEtrimmed” in a new window. Check “translation”. Investigate
all 3 reading frames to find out if there is one not resulting in stop codons (*)
4