RGMa, RGMb and RGMc are skeletal muscle proteins, and RGMa promotes
cellular hypertrophy and is necessary for myotube fusion
Aline Fagundes Martins1, José Xavier Neto2,3, Ana Azambuja3, Maria Lorena
Sereno4, Antonio Figueira4, Paulo Henrique Campos-Junior1, Millor Fernandes
Rosário5, Cristiane Bittencourt Barroso Toledo¹, Gerluza Aparecida Borges
Silva1, Gregory Thomas Kitten1, Luiz Lehmann Coutinho6, Susanne Dietrich7,
Erika Cristina Jorge1*
1Universidade
Federal de Minas Gerais – Departamento de Morfologia, Av.
Antônio Carlos, 6627, Belo Horizonte, MG, 31270-901, Brazil;
2Centro
Nacional de Pesquisa em Energia e Materiais (CNPEM) – Laboratório
Nacional de Biociências (LNBio), Rua Giuseppe Máximo Scolfaro, 10.000,
Campinas, SP, 13083-970, Brazil;
3Universidade
de São Paulo – Hospital das Clínicas da Faculdade de Medicina –
Instituto do Coração, Av. Dr. Enéas de Carvalho Aguiar, 44, São Paulo, SP,
05403-900, Brazil;
4Universidade
de São Paulo – Centro de Energia Nuclear na Agricultura, Av.
Centenário, 303, Piracicaba, SP, 13400-970, Brazil;
5Universidade
Federal de São Carlos – Centro de Ciências Naturais, Campus
Lagoa do Sino, Rodovia Lauri Simões de Barros, km 12, SP-189, Buri, SP, Brazil;
6Universidade
de São Paulo – Escola Superior de Agricultura Luiz de Queiroz,
Departamento de Zootecnia, Av. Pádua Dias, 11, Piracicaba, SP, 13418-900,
Brazil;
7University
of Portsmouth – School of Pharmacy & Biomedical Sciences, St. Michael’s Building, PO1 2DT, Portsmouth, UK.
*Correspondence
to: Erika Cristina Jorge, Universidade Federal de Minas Gerais,
Departamento de Morfologia, Laboratório de Biologia Oral e do Desenvolvimento,
Av. Antônio Carlos, 6627, CEP 31270-901, Belo Horizonte, MG, Brazil.
ecjorge@icb.ufmg.br
1
Abstract
Repulsive guidance molecules (RGMs) compose a family of glycosylphosphatidylinositol (GPI)-anchor axon guidance molecules and perform several functions
during neural development. New evidence has suggested possible new roles for
these axon guidance molecules during skeletal muscle development, which has
not been investigated thus far. In the present study, we show that RGMa, RGMb
and RGMc are all induced during skeletal muscle differentiation in vitro. Immunolocalization performed on adult skeletal muscle cells revealed that RGMa,
RGMb and RGMc are sarcolemma proteins. Additionally, RGMa was found to be
a sarcoplasmic protein with a surprisingly striated pattern. RGMa co-localization with known sarcoplasmic proteins suggested that this axon guidance molecule is a skeletal muscle sarcoplasmic protein. Western blot analysis revealed
two RGMa fragments of 60 and 33 kDa, respectively, in adult skeletal muscle
samples. RGMa phenotypes in skeletal muscle cells (C2C12 and primary myoblasts) were also investigated. RGMa over-expression produced hypertrophic
cells, whereas RGMa knockdown resulted in the opposite phenotype. RGMa
knockdown also blocked myoutbe formation in both skeletal muscle cell types.
Our results are the first to show an axon guidance molecule as a skeletal muscle
sarcoplasmic protein and to include RGMa in a system that regulates skeletal
muscle cell size and differentiation.
2
Keywords: Axon guidance, skeletal muscle, sarcomere proteins, C2C12 and primary cultures.
Introduction
Repulsive guidance molecules (RGM) are a family of GPI-anchor proteins composed of RGMa, RGMb (also known as DRAGON), RGMc (also known as Hemojuvelin, HJV, and HFE2), and RGMd. In addition to the GPI-anchor at the C-terminal region, RGM proteins also present an N-terminal signal peptide and a
partial von Willebrand type D domain, which includes a catalytic cleavage site
(Monnier et al., 2002; Samad et al., 2004). Both RGMa and RGMc also present
the putative RGD motif (Arg-Gly-Asp), which is possibly associated with a cellcell adhesion mechanism.
The functional studies available thus far have revealed RGMa and RGMb phenotypes primarily in neural tissues. RGMa mutant mice showed an exencephalic
phenotype (Niederkofler et al., 2004). RGMa was also found to be a regulator
of neural cell proliferation, differentiation, and survival (Matsunaga et al.,
2004; Matsunaga et al., 2006). RGMa is also produced by microglia/macrophages in sites of central nervous system injuries (Kitayama et al., 2011); significant axon regeneration can be observed when RGMa is blocked (Hata et al.,
2006). Likewise, RGMa inhibition was associated with neuroprotection after
cerebral ischemia (Kong et al., 2013) and with the improvement of afferent
synapse formation with auditory hair cells (Brugeaud et al., 2013). The functional diversity of RGMa observed in the nervous system is based on its capacity
3
to undergo posttranslational modifications in specific cleavage sites by the proprotein convertases Subtilisin Kexin Isozyme 1 (SKI-1), Furin and phospholipases, which result in four membrane-bound and three soluble possible RGMa
forms in this system (Tassew et al., 2012).
RGMb was found to induce the adhesion of the dorsal root ganglia neurons (Samad et al., 2004). However, RGMb knockout mice die without apparent neural
defects (Mueller et al., 2006). In contrast, RGMc was found in skeletal muscle,
liver, bone and cartilage (Schmidtmer & Engelkamp, 2004; Samad et al., 2004;
Niederkofler et al., 2004; Papanikolaou et al., 2004; Rodriguez et al., 2007;
Kanomata et al., 2009). The lack of a functional RGMc causes a disorder known
as hereditary hemochromatosis that accumulates iron in the heart, liver, skeletal muscle, endocrine glands, joints and skin cells (Pietrangelo, 2007). No
function has been assigned to RGMd thus far.
New evidence has suggested possible roles for RGMs during skeletal muscle development. RGMa, RGMb and RGMc transcripts were detected during the induced differentiation of C2C12 myoblast cells (Kanomata et al., 2009). The
functional information available for RGMs thus far in this tissue was performed
with a focus on RGMc because RGMc is known as the skeletal muscle form of
RGM. RGMc over-expression in C2C12 cells promoted myoblast differentiation
and recruitment into myotubes (Kang et al., 2004; Bae et al., 2009). Additionally, RGMa and RGMb were both detected outside the nervous system, particularly at the somites of chicken embryos (Jorge et al., 2012). RGMa transcripts
were found in domains known to be the origin site of skeletal muscle pioneer
and stem cells, and later, RGMa was found at the myotome (Jorge et al., 2012).
4
RGMb was found to overlap at sites of differentiated muscle cells, and at later
stages, at craniofacial, limb and body muscles (Jorge et al., 2012). Possible
phenotypes of RGMa and RGMb in skeletal muscle cells have not been investigated thus far.
In the present study, we show new evidence of RGMa, RGMb, and RGMc as skeletal muscle proteins and suggest an association of RGMa with the system that
regulates skeletal muscle cell size and differentiation.
Material and Methods
Animals
Male Swiss mice (60 days old; weight: ±30 g) were obtained from University
Central vivarium (CEBIO/UFMG). All animal procedures were conducted following the instructions of the university’s ethics committee (CEUA/UFMG, ethical approval 18/2011) and the Brazilian laws for the use of animals in scientific
experiments.
Cell Culture
C2C12 myoblasts were maintained in growth medium [Dulbecco’s modified Eagle’s medium (DMEM) with high glucose and L-glutamine (Gibco)], supplemented with 10% fetal bovine serum (Gibco), and a 1% penicillin/streptomycin/amphotericin B solution (Gibco) at 37 °C and 5% CO2. Myogenic differentiation was induced by culturing cells at low serum conditions [differentiation
medium: DMEM with high glucose, L-glutamine, and 2% horse serum (Gibco, Life
Technologies)]. The medium was replaced every two days.
5
For the primary cell culture, muscles were harvested from the hindlimbs of five
neonatal mice (three days old) in DPBS (Gibco) supplemented with a 1% penicillin/streptomycin/amphotericin B solution and 1% gentamicin (Sigma-Aldrich). The cells were dissociated by Collagenase I digestion (Gibco) and mechanically during 45 min at 37 °C, followed by 0.25% Trypsin digestion, for 30
min at 37 °C. Primary cultures were enriched for myoblasts after rounds of
trypsinazation and selective adhesion. The cells were seeded on 24-well plates
at a cell density of 2×104 in growth medium supplemented with 20% FBS onto
matrigel (BD Biosciences) and kept under standard conditions. Enrichment for
myoblasts was confirmed by immunofluoresce staining, using anti-Desmin and
anti-Myosin Heavy Chain antibodies. Differentiation induction was performed
as described for the C2C12 cell line.
RT-qPCR
C2C12 cells were seeded at a cell density of 2×104 in growth medium and in
duplicate in two 24-well plates (A and B biological replicates). After 24 h of
incubation, the medium was removed, and the cells from two wells from each
plate were harvested in TRIzol® Reagent (Life Technologies), which was defined as day 0. The media from the other wells were replaced to induce cell
differentiation. The cells were similarly harvested in TRIzol® Reagent every
day for up to 5 days, totaling 6 samples in duplicate. Total RNA was obtained
from each sample following the TRIzol® Reagent manufacturer’s instructions.
Total RNA was converted into cDNA from the poly(A) tail, following the SuperScript® III First Strand Synthesis System instructions (Life Technologies).
6
Primers were designed using Primer3 software (http://bioinfo.ut.ee/primer30.4.0/) to allow the amplification of ca. 200 bp of each reference and target
gene. The following mouse genes were used as references for the quantitative
analysis:
Beta-Actin
CAATCCACACA),
Beta
(Actb:
CGTTGACATCCGTAAAGACC;
2-Microglobulin
(B2M:
TAGAGCCAC-
CTCCCCAAATTCAAGTGT;
GTGAGCCAGGATGTAG), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH:
GTGAAGGTCGGTGTGAACG; ATTTGATGTTAGTGGGGTCTCG) and Ribosomal protein L7 (RPL7: GATAACTCCTTGGTTGCTC; CCAGCGTCTCCACCTTCTAC). RGMa
(CCACATCAGGAAGGCAGAAG;
GCGTAGCACTGGGTAGGAAG),
RGMb
(CTCAATGCCGAATCCAGAAA; TGCCTAACACAGCAGAATGG), and RGMc (GCTTGACCTCGGGAAACA; AGGAGCAGCAGGAGAGTGAG) were used as targets.
RT-qPCR was performed in a Rotor-Gene Q Real-time PCR system (Qiagen) using
1X Platinum® SYBR® Green qPCR SuperMix-UDG (Life Technologies) and 0.2-0.5
μM of each primer for a final volume of 10 μL. The samples were run in duplicate in 0.2 μL PCR tubes. The cycling parameters were as follows: 50 °C × 2
min, 95 °C × 2 min, followed by 40 cycles of 95 °C × 15 sec, 60-62 °C × 30 sec,
and 72 °C × 20 sec. The dissociation step was performed at the end of the
amplification step to allow the identification of the specific melting temperature for each primer set.
Immunolocalization
Quadriceps, soleus and EDL (extensor digitorum longus) muscles were harvested from five adult Swiss mice and cryopreserved in an ultrafreezer. These
muscles were specifically chosen in order to have the description of RGMs pattern in different representatives of fiber types. The muscles were embedded
7
in Tissue-Tek OCT and cut into 6 µm thick cryosections. After 30 min of TBSTC blocking, the sections were incubated with primary antibodies at 4 °C overnight. Corresponding fluorescent secondary antibodies were incubated for 90
min at RT. Antibodies were used as follows. Primary antibodies were diluted
at 1:100 in PBS. Goat polyclonal against the C-terminal RGMa (Santa Cruz Biotechnology), rabbit polyclonal against the N-terminal RGMa (Abcam), rabbit polyclonal RGMb (Santa Cruz Biotechnology), rabbit polyclonal RGMc (Santa Cruz
Biotechnology), mouse monoclonal Titin (Developmental Studies Hybridoma
Bank), mouse monoclonal Desmin (Cell Marque) and mouse monoclonal Dystrophin (Developmental Studies Hybridoma Bank). Secondary antibodies were coupled to a fluorochrome, either Alexa 555 or 488 (Molecular Probes), at a 1:500
dilution. Negative controls were determined in the absence of the respective
primary antibodies on each slide.
Immunohistochemistry
Quadriceps, soleus and EDL (extensor digitorum longus) muscles were collected
from five adult Swiss mice, fixed in cold methanol/DMSO (80% methanol and
20% DMSO). Six micrometer sections were blocked with TBS-TC for 30 min and
incubated with antibodies against the C- and N-termini of RGMa diluted in PBS
1:100. An LSAB System-HRP kit was used following the manufacturer’s instructions (Dako). The signals were detected using 3,30-diaminobenzidine (DAB,
Dako), and the sections were counterstained with Harris´ hematoxylin.
Western Blot
Mouse adult quadriceps, brain and primary myoblasts were used as samples.
Primary myoblasts were harvested from five neonate mice hindlimbs (3 days
8
old) seeded at a density of 8×104 cells/well, grown for 2 days in growth medium
and incubated a further 3 days after transfection and induction of differentiation (see procedures below). The samples were homogenized with protease
inhibitors (Sigma-Aldrich) as follows: Fluoret Fenylmethano Sulfonyl, Pepstatin
A,
EDTA,
E-64
{N-[N-(L-3-trans-carboxyirane-2-carbonyl)-L-leucyl]-ag-
matine;[1-[N-[(L-3-trans-carboxyoxirane-2-carbonyl)-L-leucyl]amino]-4-guanidinobutane]}, orthovanadate sodium. After sonication, the lysates were centrifuged at 14,000×g for 30 min, and the supernatants were diluted 1:2 in 10%
SDS, glycerol, and 10% bromophenol blue in 0.5 M Tris buffer (pH 6.8) and boiled
for 5 min. Aliquots (20 µl) of each protein were separated in denatured 12%
SDS-polyacrylamide minigels and transferred onto Hybond-ECL nitrocellulose
membranes (GE Healthcare) at 100 mA for 75 min. Blocking was performed
with TBS-TC buffer for 30 min at RT. The membranes were incubated for 120
min at RT with primary antibodies against the C- and N-termini of RGMa (1:500)
and a mouse β-actin antibody (1:5000) (Abcam) as the control. After washing,
the membranes were incubated for 1 h with the following secondary antibodies,
diluted in PBS 1:1000: biotinylated anti-goat IgG antibody (Abcam), biotinylated
anti-rabbit IgG antibody (Abcam), and biotinylated anti-mouse IgG antibody
(Abcam), followed by incubation with a streptavidin solution (Thermo Fisher
Scientific) for 15 min at RT. The signals were detected using DAB (Sigma-Aldrich), chloramphenicol (Sigma-Aldrich) and hydrogen peroxide (Sigma-Aldrich)
for 1 min at RT. Images were obtained using an Epson Perfection 4990 photo
scanner.
9
Plasmids
Chicken RGMa CDS (GenBank accession number AY128507) was cloned into the
bicistronic plasmid pCAB-IRES-eGFP (Alvares et al., 2003) at the ClaI and EcoRI
sites. The empty vector was used for control experiments. Short interfering
RNAs (siRNA) to promote RGMa knockdown and control siRNAs were gifts from
Dr. Alain Chédotal (Centre de Recherche Institut de la Vision, Paris, France).
The U6 promoter associated with the RGMa siRNA was subcloned into the
pcDNA3-eGFP (Addgene) expression vector at the EcoRI and KpnI sites.
Cell transfections
Myoblast cells were transfected after 24 h of seeding using 0.8 μg of plasmids
and Lipofectamine 2000 Reagent (Life Technologies) in Opti-MEM (Gibco) following the manufacturers’ instructions. After 5 h of incubation at 37 °C and
5% CO2, the medium was replaced with fresh growth medium. After 24 h, the
cells were trypsinized and plated onto glass slides covered with 3% gelatin in
PBS. After reaching 70% confluence, the cells were cultured in differentiation
medium for 3 and 5 days for immunostaining analysis. Transfection efficiency
was around 5%.
Cell culture immunofluorescence
After 3 and 5 days in differentiation medium, both the C2C12 and primary myoblast cells were fixed with 4% PFA and treated with 0.1% Igepal (Sigma-Aldrich)
and 1% BSA (Sigma-Aldrich) at 37 °C for 30 min. Rabbit anti-GFP (Abcam) and
mouse anti-Myosin Heavy Chain MHC (Developmental Studies Hybridoma Bank),
both diluted 1:500 in 1% BSA, were incubated overnight at 4 °C. Goat anti-
10
rabbit coupled to Alexa 488, and donkey anti-mouse 555 (Life Technologies),
both diluted 1:500 in PBS, were respectively used as secondary antibodies, for
90 min at 4 °C. The nuclei were counterstained with DAPI.
Microscopy and analysis
Immunostaining images were captured using an Olympus Q Color 3 fluorescence
microscope with an Olympus BX51 camera and Image Pro Express Software (version 4.5) or using a Zeiss 510 Meta confocal microscope. The immunohistochemistry results were photographed using a BX-41 Olympus microscope with a
Q-Color 3/Olympus capture system. Adobe Photoshop CS6 software was used
for image assembly. Length and width were measured in
all transfected
(GFP+/MHC+) cells from at least six wells for each treatment, using ImageJ software. For cell measurement, immunostained sections were scanned at an objective magnification of 20x and a projection magnification of 2x. A stage micrometer was used for standardized analysis. Digitized slides comprised TIFF
images of 2018x1536 pixels. The fusion index was calculated as the ratio of the
number of nuclei inside multinculeated myotubes (>3 nuclei) over the total nuclei number 100, at day 5 of myogenic differentiation.
Statistical Analysis
RT-qPCR data were analyzed following the instructions of Willems et al. (2008),
with a 95% confidence interval.
RGMa in vitro phenotypes (morphometric traits of length and width, and nuclei
score) were analyzed using the F-test, which was verified by SASLAB of SAS
software and corrected when necessary. ANOVA was employed to detect the
11
differences between two treatments, and the means (± standard error) were
compared by least squares (P < 0.05) using PROC GLM (SAS, 2007). For the
observed percentages, we used the chi-square test implemented in the PROC
FREQ (SAS, 2007), considering the expected frequencies as 50% for each treatment. Any deviation between the observed and expected frequencies was significant at P < 0.05. We plotted graphs to present all of the results.
Results
Expression pattern of RGMs during skeletal muscle in vitro differentiation
To investigate possible roles of RGMs in skeletal muscle cells, we turned to the
C2C12 cell lineage to detect RGMs expression levels during 5 days under serumdeprived conditions to induce cell differentiation. RGMa, RGMb, and RGMc
transcripts were detected during all stages of C2C12 differentiation (Fig. 1AC). During all differentiation stages (D1-D5), both RGMa and RGMc have presented expression levels higher (P < 0.05) than that detected at the corresponding D0 stage, in which cells were cultivated exclusively in growth medium (Fig.
1A and C). RGMb expression levels did not differ from those levels observed
during the proliferative phase (Fig. 1B). These findings suggested the presence
of RGMa, RGMb and RGMc transcripts during skeletal muscle cell differentiation.
RGMa, RGMb and RGMc immunolocalization in adult skeletal muscle cells
Despite the detection of RGMs transcripts in skeletal muscle cells in culture, no
information regarding the localization of these proteins in adult skeletal muscle
12
tissues has been available thus far. To determine the localization of RGMa,
RGMb, and RGMc in skeletal muscle cells, samples of quadriceps (mostly fast),
soleus (slow) and EDL (mixed) muscles were (transversally and longitudinally)
cryosectioned and subjected to immunofluorescence staining for RGMa, RGMb
and RGMc. As no difference in expression pattern was observed in different
muscle types, the best representative pictures among the used muscles were
presented.
RGMa immunolocalization (C-terminal) on transversal skeletal muscle cryosections revealed signals of this axon guidance molecule detected as small dots
both in the sarcolemma (Fig. 2A, arrows heads) and all over the sarcoplasm
(Fig. 2A, arrows). RGMb and RGMc signals in transversal cryosections revealed
the presence of these proteins exclusively in the surrounding sarcolemma (Fig.
2C and E). When longitudinal cryosections were used, RGMa immunostaining in
the sarcoplasm was surprisingly found in a striated pattern (Fig. 2B) resembling
sarcomeric protein staining, whereas RGMb and RGMc were restricted to the
sarcolemma (Fig. 2D and F).
As GPI-anchor proteins, RGMs were expected to be found exclusively in membranes. Membrane-bound and soluble forms, but no cytoplasmic forms, were
previously described for RGMa in other cell types (Tassew et al., 2012). To
confirm our data, a second antibody was used against the RGMa N-terminal
domain. Transversal (Fig. 3B and E) and longitudinal (Fig. 3A and D) sections
presented similar results for both antibodies. RGMa striated pattern in the
sarcoplasm was also confirmed by immunohistochemistry performed using both
C- and N-terminal RGMa antibodies (Fig. 4A and C).
13
Our data revealed all mammalian RGMs in the sarcolemma of skeletal muscle
cells and suggested an additional role for RGMa as a sarcoplasmic striated protein.
RGMa fragments present in skeletal muscle cells
A Western blot was performed to confirm C- and N-terminal RGMa antibodies
specificities in skeletal muscle cells. A brain sample was used as a control. In
addition to confirming antibody specificities, our results revealed the presence
of two RGMa fragments, a 60 kDa fragment and a 33 kDa fragment, in skeletal
muscle tissues using a C-terminal antibody (Fig. 5A). The N-terminal antibody
allowed the identification of the 60 kDa fragment only (Fig. 5B). These results
suggested the presence of two different RGMa fragments in skeletal muscle
cells.
Co-localization of RGMa with known skeletal muscle proteins
The unexpected striated aspect of RGMa in myofibers led us to investigate
whether this axon guidance protein co-localizes with known skeletal muscle
proteins. For this experiment, double labeling was performed in longitudinal
sections using RGMa, Desmin, and Titin antibodies. Our results showed that
RGMa co-localizes with Desmin (Fig. 6A-D) and Titin (Fig. 6E-H) proteins, suggesting an association between RGMa and the skeletal muscle sarcomeres, possibly with the Z-disks.
14
RGMa in vitro phenotype
After 5 days in DM, primary muscle MHC-positive/RGMa-positive cells presented
an increase in cell width (p<0.05), compared to the control (MHC-positive/pCAb-positive) cells (Fig. 7A). The same effect was observed in RGMapositive C2C12 cells (Fig.7A). No significant difference was observed in cell
length for both muscle cultures (data not shown). RGMa knockdown resulted
in the opposite effect: a decrease in width of MHC-positive/RGMa-knockdown
cells was observed, compared to the controls (Fig. 7C). RGMa knockdown in
C2C12 cells resulted in the same phenotype (Fig. 7D). Western blot analysis
confirmed the efficiency of our transfections (Fig. 7E).
Additionally, it was also possible to note that MHC-positive/RGMa-positive cells
displayed a trend to increase the total number of nuclei (44.4%), compared to
the control (35.6%). Taken together, these results suggested that RGMa could
induce hypertrophy in skeletal muscle cells, possibly through a mechanism dependent of nuclear accretion.
RGMa and myotube formation
To evaluate the role of RGMa during skeletal muscle development, we scored
the number of nuclei (1n, 2-4n, and >5n) in MHC-positive/RGMa-positive and
MHC-positive/RGMa-knockdown cells (primary muscle culture); and in RGMapositive and RGMa-knockdown C2C12 cells, after 3 and 5 days in DM.
MHC-positive/RGMa-positive cells did not display any significant difference in
the average number of nuclei per multi-nucleated myotube, compared to the
control (data not shown). Significant difference was found when RGMa was
15
knockdown: MHC-positive/RGMa-knockdown cells were blocked from forming
multi-nucleated myotubes after 3 and 5 days in DM (Fig. 8A). It was not possible
to find MHC-positive/RGMa-knockdown multi-nucleated myotubes (presenting 2
or more nuclei) (Fig. 8A). The same results were obtained when C2C12 cells
were used (data not shown).
To identify a possible effect of RGMa in myoblasts fusion during cell differentiation, the fusion index was assessed in MHC-positive/RGMa-positive multi-nucleated myotubes, after 5 days in DM. An increase of 3-fold in the fusion index
(p˂0.05) was observed in cells over-expressing RGMa, compared to the control
(Fig. 8B). This result suggested that RGMa over-expressing muscle cells were
more efficient to fuse.
All together, these results suggest that RGMa is necessary for myotube formation, as it interferes in myoblast fusion.
Discussion
RGMa is an axon guidance molecule first described as playing roles during neurogenesis as repulsive cues to axonal outgrowth (Monnier et al., 2002). Later,
other members of this family were described based on their sequence similarities: RGMb, RGMc, and RGMd. Neural association was found to be restricted to
RGMa and RGMb (Hata et al., 2006; Liu et al., 2009). RGMc was described as
the skeletal muscle member of this family, playing roles in the regulation of
hepcidin expression (Babitt et al., 2006; Truksa et al., 2006; Babitt et al., 2006)
and of iron homeostasis (reviewed by Papanikolaou et al., 2003).
16
Recently, additional roles for RGMa and RGMb in other tissues, including skeletal muscle, have been proposed (Kanomata et al., 2009; Jorge et al., 2012). In
chicken, RGMa transcripts were found in domains of epithelial somites that
generate skeletal muscle pioneer and stem cells, and later RGMa transcripts
were found at the myotome in mature somites (Jorge et al., 2012). RGMb transcripts were found in sites of differentiated muscle cells, and at later stages,
at craniofacial, limb and body muscles (Jorge et al., 2012). In the present
study, we provided new insights into the association of RGMs and skeletal muscle cells.
RGMa, RGMb and RGMc are all induced during skeletal muscle cell differentiation
RGMa and RGMc were up-regulated during the induction of C2C12 cell differentiation, as detected by RT-qPCR. RGMa and RGMc were both up-regulated as
soon as GM was changed by DM (D1). Another quantitative study performed on
C2C12 cells revealed RGMa and RGMb expression in both GM and DM, whereas
RGMc was restricted to myogenin-expressing cells (Kanomata et al., 2009). Despite the detection of RGMs on C2C12 cells, no further in vitro investigation has
been performed thus far to understand the specific functions of RGMs on these
cells. Our findings suggested overlapping functions of RGMa and RGMc during
skeletal muscle cell differentiation.
RGMa, RGMb and RGMc are all found as skeletal muscle proteins
Our analysis performed in adult skeletal muscle cells revealed that RGMa, RGMb
and RGMc are all found in the surrounding sarcolemma. Additionally, RGMa was
found in the sarcoplasm with a surprisingly striated pattern that was confirmed
17
by immunofluorescence and immunohistochemistry assays. The striated pattern
of RGMa resembled those of known sarcomeric proteins, such as Titin and Desmin. Our findings strongly suggested that (1) RGMs play roles as skeletal muscle
proteins, (2) RGMs might present overlapping or regulatory roles on the sarcolemma, and (3) RGMa plays an additional role inside the sarcoplasm of these
cells most likely as a sarcomere-associated protein.
A Western blot performed using RGMa C- and N-terminal antibodies on samples
of skeletal muscle tissue confirmed the antibody specificities. In addition, this
assay also corroborated our immunolocalization data, confirming the presence
of two RGMa fragments of 60 and 33 kDa in this tissue. Multiple membranebound and soluble RGMa forms were described in fibroblast-like cells transfected with the full-length RGMa: four membrane-bound (a cleaved and an uncleaved full length fragment, both of 60 kDa each; a C-terminal fragment of 33
kDa; and a 37 kDa fragment); and three soluble forms (two small N-terminal
fragments of 30 kDa; and a secreted 60 kDa form with no GPI-anchor) (Tassew
et al., 2009; Tassew et al., 2012). The current work revealed the presence of
two of these RGMa forms in skeletal muscle cells, possible the full-length 60
kDa and a fragment of 33 kDa, the product of an autocatalytic site present at
the C-terminal domain of this protein. This result intriguingly suggested two
different functions for this axon guidance molecule in skeletal muscle cells. To
our knowledge, this work is the first to show a repulsive guidance molecule
(RGMa) inside the cytoplasm. The functions of RGMs on the sarcoplasm and
sarcolemma of skeletal muscle cells remain unknown.
18
RGMa in vitro phenotype
Our RGMa in vitro phenotypes, which were investigated using C2C12 and primary myoblast cells, revealed that RGMa over-expressing cells formed larger
myotubes, in comparison to the control. A trend to increase the total number
of nuclei in MHC-positive/RGMa-positive cells was also observed, suggesting an
association of RGMa with the mechanism of nuclei accretion during skeletal
muscle differentiation.
Additionally, RGMa over-expressing muscle cells
showed a higher efficiency in fusion, compared to the control. RGMa knockdown revealed the opposite effect, resulting in the appearance of smaller cells,
with deficient ability to form multi-nucleated myotubes. These results allowed
us to assign a role for RGMa as a positive regulator of skeletal muscle cell size
and differentiation, possibilly through a mechanism of induction of cell fusion.
Molecules involved in different mechanisms have already been associated with
myofiber cell size and differentiation; for example IGF-1 signaling molecules
(Coleman et al., 1995), the TGF-β super-family members Myostatin and BMP
(McPherron et al., 1997; Lee & McPherron, 2001; Walsh et al., 2010), and Pax3
and Pax7, which are known myogenic markers that induce cell size and morphology phenotypes (Collins et al., 2009). Likewise, Neogenin, Netrin and RGMc
have also been associated with the system that regulates skeletal muscle cell
size and differentiation. Neogenin over-expression in C2C12 cells resulted in
the appearance of larger myotubes and with more nuclei than did C2C12/puro
cells (Kang et al., 2004). In fact, C2C12/neogenin cultures displayed an increase
in the total number of nuclei present in MHC+ cells and in the average number
of nuclei/myotube (Kang et al., 2004). The same phenotype was observed when
19
cultures were treated with Netrin-2 (the chick family member most closely related to mammalian Netrin-3) and when RGMc was over-expressed. However,
the effects of RGMc on the cells were less pronounced than when Netrins were
used (Kang et al., 2004; Bae et al., 2009) and some studies even report that
RGMc over-expression in C2C12 cells has no effect on myotube formation
(Huang et al., 2005; Kuninger et al., 2006). Myoblasts derived from a homozygous gene-trap mutation in the Neo1 locus developed smaller myotubes with
fewer nuclei than myoblasts from control animals, with inefficient expression
of muscle-specific proteins (Bae et al., 2009). A similar phenotype was observed in GFP-sorted cells that received a Neogenin RNAi vector because these
cells produced smaller and fewer myotubes than did sorted control transfectants (Kang et al., 2004).
However, the molecular mechanisms that allow RGMa (and possibly the other
RGMs) to regulate skeletal muscle cell size and differentiation remain unknown
and must be further addressed. The first suggestion would be through the Neogenin receptor, based on similar findings. Neogenin binding to the axon guidance molecule Netrin was found to induce E-proteins, myogenic bHLH factors,
SRF and NFATc3 to drive the transcription of muscle-specific genes to regulate
the actin cytoskeleton and the differentiation into multinucleated myotubes
(Cole et al., 2004; Krauss, 2005). Netrin-3/Neogenin binds to the CDO co-receptor to activate NFATc3, which is a candidate for the regulation of myoblast
morphology, and the Focal adhesion kinase (FAK) and the extracellular signalregulated kinase (ERK), which are both involved in the signaling that regulates
myotube formation (Yokoyama et al., 2007; Bae et al., 2009; Quach et al.,
2009).
20
RGMa was also reported as a BMP co-receptor (Samad et al., 2005; Babitt et
al., 2005; Babitt et al., 2006), and BMP signaling through Smad1/5/8 was recently associated with skeletal muscle cell size regulation (Sartori et al., 2013).
The over-expression of ALK3 (BMP receptor) enhanced Smad1/5/8 phosphorylation, resulting in increased fiber size, leading to massive muscle hypertrophy
(Sartori et al., 2013). When Noggin (a BMP antagonist) was over-expressed, a
reduction of Smad1/5/8 phosphorylation was observed, which caused muscle
atrophy (Sartori et al., 2013). Curiously, the over-expression of both RGMa and
RGMc in C2C12 cells significantly enhanced BMP activity compared with that
observed for RGMa or RGMc individually (Halbrooks et al., 2007). Conversely,
the selective knockdown of RGMa, RGMb, or RGMc resulted in a dramatic decrease in BMP activity, which was more pronounced when RGMa and RGMc were
suppressed (Halbrooks et al., 2007). However, RGMa was seen to have a less
prominent function as a BMP co-receptor when compared to other RGMs (Wu et
al., 2012). Our results of muscle hypertrophy are also similar to ALK3 phenotypes, and one hypothesis is that RGMa may function as a BMP signaling enhancer. The involvement of RGMa and BMP signaling in muscle size requires
further attention.
Taken together, these data provide insights regarding RGMa as a key player in
regulating skeletal muscle size and differentiation, highlighting its possible
association with the dynamic and intricate cytoskeleton of skeletal muscle
cells.
21
Acknowledgments
The present study was supported by CNPq and UFMG/PRPq. Aline F Martins was
funded by Capes. Luiz L Coutinho and Millor F Rosário received scholarships
from CNPq. S Dietrich received an AFM research grant.
REFERENCES
Alvares, L.E., Schubert, F.R., Thorpe, C., Mootoosamy, R.C., Cheng, L., Parkyn,
G., Lumsden, A., Dietrich, S (2003) Intrinsic Hox-dependent cues determine the
fate of skeletal muscle precursors. Developmental Cell 5(3), 379-90.
Babitt, J.L., Zhang, Y., Samad, T.A., Xia, Y., Tang, J., Campagna, J.A.,
Schneyer, A.L., Woolf, C.J., Lin, H.Y (2005) Repulsive guidance molecule
(RGMa), a DRAGON homologue, is a bone morphogenetic protein co-receptor.
The Journal of Biological Chemistry 280, 29820-29827.
Babitt, J.L., Huang, F.W., Wrighting, D.M., Xia, Y., Sidis, Y., Samad, T.A., Campagna, J. A., Chung, R. T., Schneyer, A. L., Woolf, C. J., Andrews, N. C., Lin,
H. Y (2006) Bone morphogenetic protein signaling by hemojuvelin regulates
hepcidin expression. Nature Genetics 38, 5, 531-539.
Bae, G.U., Yang, Y.J., Jiang, G., Hong, M., Lee, H.J., Tessier-Lavigne, M.,
Kang, J.S., Krauss, R.S (2009) Neogenin regulates skeletal myofiber size and
focal adhesion kinase and extracellular signal-regulated kinase activities in vivo
and in vitro. Molecular Biology of the Cell 20, 4920-4931.
22
Brugeaud, A., Tong, M., Luo, L., Edge, A.S (2013) Inhibition of repulsive guidance molecule, RGMa, increases afferent synapse formation with auditory hair
cells. Developmental Neurobiology.
Cole, F., Zhang, W., Geyra, A., Kang, J.S., Krauss, R.S. (2004). Positive regulation of myogenic bHLH factors and skeletal muscle development by the cell
surface receptor CDO. Developmental Cell 7, 843-854.
Coleman, M.E., DeMayo, F., Yin, K.C., Lee, H.M., Geske, R., Montgomery, C.,
Schwartz, R.J (1995). Myogenic vector expression of insulin-like growth factor
I stimulates muscle cell differentiation and myofiber hypertrophy in transgenic
mice. The Journal of Biological Chemistry 270, 12109-12116.
Collins, C.A., Gnocchi, V.F., White, R.B., Boldrin, L., Perez-Ruiz, A., Relaix, F.,
Morgan, J.E., Zammit, P.S (2009) Integrated functions of Pax3 and Pax7 in the
regulation of proliferation, cell size and myogenic differentiation. PloS One 4,
e4475.
Halbrooks, P.J., Ding, R., Wozney, J.M., Bain, G (2007) Role of RGM coreceptors
in bone morphogenetic protein signaling. Journal of Molecular Signaling 2, 4.
Hata, K., Fujitani, M., Yasuda, Y., Doya, H., Saito, T., Yamagishi, S., Mueller,
B.K., Yamashita, T (2006). RGMa inhibition promotes axonal growth and recovery after spinal cord injury. The Journal of Cell Biology 173, 47-58.
Huang, F.W., Pinkus, J.L., Pinkus, G. S., Fleming, M.D., Andrews, EN.C (2005).
A mouse model of juvenile hemochromatosis. The Journal of Clinical Investigation, 115, 8, 2187-2191.
23
Jorge, E.C., Ahmed, M.U., Bothe, I., Coutinho, L.L., Dietrich, S (2012) RGMa
and RGMb expression pattern during chicken development suggest unexpected
roles for these repulsive guidance molecules in notochord formation, somitogenesis, and myogenesis. Developmental Dynamics 241, 1886-1900.
Kang, J.S., Yi, M.J., Zhang, W., Feinleib, J.L., Cole, F., Krauss, R.S (2004) Netrins and neogenin promote myotube formation. The Journal of Cell Biology
167, 493-504.
Kanomata, K., Kokabu, S., Nojima, J., Fukuda, T., Katagiri, T (2009) DRAGON,
a GPI-anchored membrane protein, inhibits BMP signaling in C2C12 myoblasts.
Genes to Cells 14, 695-702.
Kitayama, M., Ueno, M., Itakura, T., Yamashita, T (2011) Activated microglia
inhibit axonal growth through RGMa. PloS One 6, e25234.
Kong, Y., Rogers, M.R., Qin, X (2013) Effective neuroprotection by ischemic
postconditioning is associated with a decreased expression of RGMa and inflammation mediators in ischemic rats. Neurochemical Research 38, 815-825.
Krauss, R.S., Cole, F., Gaio, U., Takaesu, G., Zhang, W., Kang, J.S (2005) Close
encounters: regulation of vertebrate skeletal myogenesis by cell-cell contact.
Journal of Cell Science 118, 2355-2362.
Kuninger, D., Kuns-Hashimoto, R., Kuzmickas, R., Rotwein, P (2006). Complex
biosynthesis of the muscle-enriched iron regulator RGMc. Journal of Cell Science 119, 3273-3283.
24
Lee, S.J., McPherron, A.C (2001) Regulation of myostatin activity and muscle
growth. Proceedings of the National Academy of Sciences of the United States
of America 98, 9306-9311.
Liu, X., Hashimoto, M., Horii, H., Yamaguchi, A., Naito, K., Yamashita, T.
(2009). Repulsive guidance molecule b inhibits neurite growth and is increased
after spinal cord injury. Biochemical and Biophysical Research Communications,
382(4), 795-800.
Matsunaga, E., Tauszig-Delamasure, S., Monnier, P.P., Mueller, B.K.,
Strittmatter, S.M., Mehlen, P., Chedotal, A (2004). RGM and its receptor neogenin regulate neuronal survival. Nature Cell Biology 6, 749-755.
Matsunaga, E., Nakamura, H., Chedotal, A (2006) Repulsive guidance molecule
plays multiple roles in neuronal differentiation and axon guidance. The Journal
of Neuroscience 26, 6082-6088.
McPherron, A.C., Lee, S.J (1997) Double muscling in cattle due to mutations in
the myostatin gene. Proceedings of the National Academy of Sciences of the
United States of America 94, 12457-12461.
Monnier, P.P., Sierra, A., Macchi, P., Deitinghoff, L., Andersen, J.S., Mann, M.,
Flad, M., Hornberger, M.R., Stahl, B., Bonhoeffer, F., Mueller, B.K (2002) RGM
is a repulsive guidance molecule for retinal axons. Nature 419, 392-395.
Mueller, B.K., Yamashita, T., Schaffar, G., Mueller, R (2006) The role of repulsive guidance molecules in the embryonic and adult vertebrate central nervous
system. Philosophical transactions of the Royal Society of London 361, 15131529.
25
Niederkofler, V., Salie, R., Sigrist, M., Arber, S. (2004). Repulsive guidance molecule (RGM) gene function is required for neural tube closure but not retinal
topography in the mouse visual system. The Journal of Neuroscience 24, 808818.
Papanikolaou, G., Samuels, M.E., Ludwig, E.H., MacDonald, M.L., Franchini,
P.L., Dube, M.P., Andres, L., MacFarlane, J., Sakellaropoulos, N., Politou, M.,
Nemeth, E., Thompson, J., Risler, J.K., Zaborowska, C., Babakaiff, R., Radomski, C.C., Pape, T.D., Davidas, O., Christakis, J., Brissot, P., Lockitch, G.,
Ganz, T., Hayden, M.R., Goldberg, Y.P. 2004. Mutations in HFE2 cause iron
overload in chromosome 1q-linked juvenile hemochromatosis. Nature Genetics
36, 77-82.
Pietrangelo, A (2007) Hemochromatosis: an endocrine liver disease. Hepatology
46, 1291-1301.
Quach, N.L., Biressi, S., Reichardt, L.F., Keller, C., Rando, T.A (2009) Focal
adhesion kinase signaling regulates the expression of caveolin 3 and beta1 integrin, genes essential for normal myoblast fusion. Molecular Biology of the Cell
20, 3422-3435.
Rodriguez, A., Pan, P., Parkkila, S (2007). Expression studies of neogenin and
its ligand hemojuvelin in mouse tissues. The Journal of Histochemistry and Cytochemistry 55, 85-96.
Samad, T.A., Srinivasan, A., Karchewski, L.A., Jeong, S.J., Campagna, J.A., Ji,
R.R., Fabrizio, D.A., Zhang, Y., Lin, H.Y., Bell, E., Woolf, C.J. (2004). DRAGON:
a member of the repulsive guidance molecule-related family of neuronal- and
26
muscle-expressed membrane proteins is regulated by DRG11 and has neuronal
adhesive properties. The Journal of Neuroscience 24, 2027-2036.
Sartori, R., Schirwis, E., Blaauw, B., Bortolanza, S., Zhao, J., Enzo, E.,
Stantzou, A., Mouisel, E., Toniolo, L., Ferry, A., Stricker, S., Goldberg, A.L.,
Dupont, S., Piccolo, S., Amthor, H., Sandri, M (2013) BMP signaling controls
muscle mass. Nature Genetics 45, 1309-1318.
Schmidtmer, J., Engelkamp, D (2004) Isolation and expression pattern of three
mouse homologues of chick RGM. Gene Expression Patterns 4, 105-110.
Tassew, N.G., Charish, J., Chestopalova, L., Monnier, P.P (2009) Sustained In
Vivo Inhibition of Protein Domains Using Single-Chain Fv Recombinant Antibodies and Its Application to Dissect RGMa Activity on Axonal Outgrowth. The Journal of Neuroscience, 29, 4, 1126–1131.
Tassew, N.G., Charish, J., Seidah, N.G., Monnier, P.P (2012) SKI-1 and Furin
generate multiple RGMa fragments that regulate axonal growth. Developmental
Cell 22, 391-402.
Truksa, J., Peng, H., Lee, P., Beutler, E. (2006). Bone morphogenetic proteins
2, 4, and 9 stimulate murine hepcidin 1 expression independently of Hfe, transferrin receptor 2 (Tfr2), and IL-6. Proceedings of the National Academy of Sciences, 103, 27, 10289 –10293.
Yokoyama, T., Takano, K., Yoshida, A., Katada, F., Sun, P., Takenawa, T.,
Andoh, T., Endo, T (2007) DA-Raf1, a competent intrinsic dominant-negative
antagonist of the Ras-ERK pathway, is required for myogenic differentiation.
The Journal of Cell Biology 177, 781-793.
27
Walsh, D.W., Godson, C., Brazil, D.P., Martin, F (2010) Extracellular BMP-antagonist regulation in development and disease: tied up in knots. Trends Cell
Biology 20, 244–256.
Willems, E., Leyns, L., Vandesompele, J (2008) Standardization of real-time
PCR gene expression data from independent biological replicates. Analytical
Biochemistry, 379(1), 127-29.
Wu, Q., Sun, C.C., Lin, H.Y., Babitt, J.L (2012). Repulsive Guidance Molecule
(RGM) Family Proteins Exhibit Differential Binding Kinetics for Bone Morphogenetic Proteins (BMPs). Plos One, 7, 9, e46307.
Figure Legends
Fig. 1. RT-qPCR data. RGMa, RGMb, and RGMc were quantified during 5 days
of C2C12 differentiation (X-axis). Relative quantification was determined following the instructions of Willems et al. (2008). The relative expression levels
of (A) RGMa, (B) RGMb, and (C) RGMc during cellular differentiation.
Fig. 2. RGMs are found at the sarcolemma of adult mouse skeletal muscle
cells, whereas RGMa is also found in the sarcoplasm, with a striated labeling
pattern. Six micrometer sections of adult mouse quadriceps and soleus muscles
were stained with RGMa (red), RGMb and RGMc (both in green) antibodies.
Transversal (A, C, and E) and longitudinal (B, D, and F) section views were taken
28
using a fluorescence microscope. (A) RGMa is found at the sarcoplasm (arrows)
and in some particular spots of the sarcolemma (arrowheads). (B) RGMa label
(red) revealing its striated expression pattern in the fiber. RGMb (C, D) and
RGMc (E, F) are found at the sarcolemma in transversal and longitudinal views.
(G) RGMa negative control. (H) RGMb and RGMc negative control. Bar, 20 µm.
Fig. 3. C-RGMa and N-RGMa confocal images. Sections (6 µm) of adult mouse
EDL and quadriceps muscles were stained for C-RGMa (red) and N-RGMa (green).
Longitudinal (A and D) and transversal (B and E) section views were taken using
a confocal microscope. (A) Longitudinal section showing the striated labeling
pattern of C-RGMa. (B) Transversal section showing C-RGMa at the sarcoplasm
and in some particular spots of the sarcolemma. (C) C-RGMa negative control,
EDL muscle. (D) Longitudinal section showing the striated labeling pattern of
N-RGMa. (E) Transversal section showing N-RGMa at the sarcoplasm and in some
particular spots of the sarcolemma. (F) N-RGMa negative control in quadriceps
muscle. Bar, 20 µm.
Fig. 4. RGMa is found at the sarcoplasm of adult mouse skeletal muscle cells
with a striated labeling pattern in immunohistochemistry sections. Six micrometer sections of adult mouse quadriceps muscle were stained for C-RGMa
and N-RGMa. Longitudinal section views were taken using an optical microscope.
(A) C-RGMa labeling.
(B) C-RGMa negative control.
(C) N-RGMa
labeling. (D) N-RGMa negative control. Bar, 20 µm.
Fig. 5. Western blot of adult mouse skeletal muscle cells. (A) Western blot
analysis of C-RGMa in adult mouse skeletal muscle and brain. Brain tissue was
used as a positive control. Two bands are visible for C-RGMa (33 and 60 kDa)
29
in both tissue samples. (B) Western blot analysis of N-RGMa in adult mouse
skeletal muscle and brain. A single 60 kDa band is visible in both tissue samples
for N-RGMa.
Fig. 6. Colocalization of RGMa with Desmin and Titin in adult mouse skeletal
muscle. Six micrometer transverse sections of EDL muscle were stained for CRGMa (red), Desmin (green) and Titin (green). Images were taken using a fluorescence microscope. (A) C-RGMa staining. (B) Desmin staining. (C) Overlay
of the immunostaining images displayed in A and B was performed using Adobe
Photoshop CS6 software. Co-localization spots of RGMa and Desmin are shown
in detail (visualized as yellow dots). (D) Overlay of immunostaining negative
controls for C-RGMa and Desmin. (E) C-RGMa staining. (F) Titin staining. (G)
Overlay of immunostaining images displayed in E and F. Co-localization spots of
RGMa and Desmin are shown in detail (visualized as yellow dots). (H) Overlay
of immunostaining negative controls for C-RGMa and Titin. Bar, 20 µm.
Fig. 7. RGMa over-expression promotes the hypertrophy of skeletal muscle
cells, whereas RGMa knockdown promotes atrophy. Primary and C2C12 cells
were
transfected
with
an
expression
vector
harboring
RGMa
cDNA
(RGMa+pCAb), with the expression vector alone (pCAb) and with an interference RNA for RGMa. Cells were stained for MHC (red) and GFP (green). Overlay
of images are shown. (A) Width of MHC+ cells carrying the GFP+(RGMa+) overexpression vector and the control (GFP+). (B) MHC+ cells are shown in yellow
at 5 days of differentiation (DM) for both RGMa+pCAb+GFP and pCAb+GFP. (C)
Width of MHC+ cells carrying the RGMa interference construct [GFP+(RGMa-)]
30
and the control vector (GFP+). (D) MHC+ are shown in yellow at 5 days of differentiation (DM) for both siRGMa+pcDNA3+GFP and pcDNA3+GFP. (E) Western
blots of the indicated cells were probed with the antibodies RGMa and β-actin,
as a control, to prove the efficacy of the treatments. Width of each cell was
measured using ImageJ software. Cell width was expressed in µm. Bar, 20 µm.
Fig. 8. RGMa knockdown blocks myotube formation. Primary and C2C12 cells
were transfected with RGMa+pCAb and siRGMa+pcDNA3 and their respective
vectors alone. Nuclei were counted after 3 and 5 days of differentiation. Quantification of myotube formation was assessed as the average number of nuclei/myotube in MHC+/GFP+ cells. (A) RGMa knockdown and pcDNA3 control
transfectant after 3 days in DM. (B) Fusion index for MHC+/GFP+(RGMa+) and
control after 5 days of differentiation (significant values are shown, p<0.05).
31