5.1.1 Cellular Control

advertisement

OCR A2 UNIT F215 CELLULAR CONTROL

Specification a) State that genes code for polypeptides, including enzymes b) Explain the meaning of the term genetic code c) Describe. with the aid of diagrams, the way in which a nucleotide sequence codes for the amino acid sequence in a polypeptide d) Describe. with the aid of diagrams, how the sequence of nucleotides within a gene is used to construct a polypeptide, including the roles of messenger

RNA, transfer RNA and ribosomes e) State that mutations cause changes to the sequence of nucleotides in DNA molecules f) Explain how mutations can have beneficial, neutral or harmful effects on the way a protein functions g) State that cyclic AMP activates proteins by altering their three-dimensional structure h) Explain genetic control of protein production in a prokaryote using the lacoperon i) Explain that the genes that control development of body plans are similar in plants, animals and fungi, with reference to homeobox sequences j) Outline how apoptosis (programmed cell death) can act as a mechanism to change body plans

1

Definitions

Word to define Definition

Gene A length of DNA (sequence of nucleotides) that codes for one polypeptide. A gene is part of a DNA molecule (one chromosome is one DNA molecule)

Polypeptide

*Note that the text book definition is incorrect

A polymer consisting of a chain of amino acids joined by peptide bonds

Genome

Protein

The entire DNA sequence of an organism. The human genome consists of about 25000 genes and 3 billion nucleotide base pairs.

In eukaryotic cells, most genes are on the nuclear chromosomes.

A few are in the mitochondria or chloroplasts

A large polypeptide (usually 100 or more amino acids). Some proteins contain one polypeptide chain; some contain more than one polypeptide chain

Types of Polypeptides/Proteins coded for by Genes

Structural proteins such as collagen

Haemoglobin

Antibodies (immunoglobulins)

Cell surface receptor proteins

Hormones such as insulin and glucagon

Regulatory proteins involved in switching genes on/off

Actin and myosin in muscle cells

Tubulin in microtubules

Channel proteins

Electron carriers

Enzymes*

Enzymes are very important proteins because they control metabolic processes in the cell, including the synthesis of non-protein molecules in cells

2

The Genetic Code

The genetic code is the genetic information that codes for the assembly of amino acids into polypeptides and proteins

Features of the genetic code

The genetic code is a triplet code . This means that each amino acid in the polypeptide is coded for by a sequence of three DNA bases. A triplet of bases is called a codon

There are 4 different bases in DNA. When these are arranged in groups of three, the number of different triplet sequences is 4 3 = 64. Since there are 20 different amino acids in proteins, 64 triplet codes is more than enough to code for 20 amino acids

The genetic code is degenerate . This means that all amino acids except methionine have more than one codon coding for them. Most of this degeneracy involves the third nucleotide in the codon. One implication is that a mutation that substitutes one DNA base for another may not alter the amino acid coded for

Some codons are stop codons. They do not code for an amino acid and their presence in the DNA sequence indicates the end of the polypeptide chain

The genetic code is non-overlapping. Each DNA base is part of the codon for only one amino acid

Non-overlapping Code: C G T A G A

(2 separate triplets, 2 amino acids coded for)

Overlapping Code : C G T A G A

CGT

GTA

TAG

AGA

(4 overlapping triplets, 4 amino acids coded for)

If the code was overlapping, more information could be stores in the same space but the code would be less flexible since each codon would depend partly on the bases of the previous codon

3

The genetic code is widespread but not universal. All organisms on Earth share the same genetic code except for a few exceptions

Tables of the genetic code can be given in terms of DNA and mRNA

The Genetic Code in terms of DNA

Use the DNA-amino acid table above to list all the DNA codons that code for each amino acid listed in the table below. The left hand column gives the first base. The top line gives the second base and the right hand column gives the third base

Amino Acid DNA codons that code for this amino acid

Ala Alanine

Arg Arginine

Asn Asparagine

Asp Aspartic acid

Cys Cysteine

Gln Glutamine

Glu Glutamic acid

Gly Glycine

His Histidine

Iso Isoleucine

GCC, GCT,

GCA, GCG

No. of codo ns

4

Amino Acid

Leu leucine

Lys lysine

Met methionine

Phe phenylalanine

Pro proline

Ser serine

Thr threonine

Try tryptophan

Tyr tyrosine

Val valine

DNA codons that code for this amino acid

No. of codons

4

The Genetic Code in terms of mRNA

Use the mRNA-amino acid table above to list all the mRNA codons that code for each amino acid listed in the table below.

Amino Acid

Ala Alanine

Arg Arginine

Asn Asparagine

Asp Aspartic acid

Cys Cysteine

Gln Glutamine

Glu Glutamic acid

Gly Glycine

His Histidine

Iso Isoleucine mRNA codons that code for this amino acid

GCC, GCU,

GCA, GCG

No. of codo ns

4

Amino Acid

Leu leucine

Lys lysine

Met methionine

Phe phenylalanine

Pro proline

Ser serine

Thr threonine

Try tryptophan

Tyr tyrosine

Val valine mRNA codons that code for this amino acid

No. of codons

5

The figure below is a circular representation of the genetic code

Answer the following questions:

1. Does the circular diagram above represent the genetic code in terms of DNA or mRNA?

…………………………………………………………………………………………

2. Where in the circle would you look for the following? (use descriptions such as middle, 1 st concentric ring and 2 nd concentric ring)

the first base in the codon

…………………………………………………………………………………………

the second base in the codon

…………………………………………………………………………………………

the third base in the codon

…………………………………………………………………………………………

6

3. Write out the following codons (remember there could be more than one codon)

Stop codons

………………………………………………………………………………………….

Glycine

…………………………………………………………………………………………..

Threonine

………………………………………………………………………………………….

4. List the amino acid sequence of the following sequence of codons:

AUGCGGUAUUUUGGAAAAGUUUGA

………………………………………………………………………………………….

5. Write an alternative codon sequence for the same amino acid sequence:

………………………………………………………………………………………….

6. Write out the DNA sequence that was transcribed to produce the mRNA strand given in question 4

………………………………………………………………………………………….

7. What is the feature of the genetic code that allows different base sequences in mRNA and DNA to code for the same amino acid sequence?

…………………………………………………………………………………………

7

The table below shows a comparison of the nucleotides in cDNA and the amino acid sequences for a protein called crystalline in the lens of the mammalian eye for three mammals

Explain why there is a higher similarity between the amino acid sequences than between the cDNA sequences (cDNA stands for copy DNA)

……………………………………………………………………………………………….

……………………………………………………………………………………………….

……………………………………………………………………………………………….

……………………………………………………………………………………………….

………………………………………………………………………………………………

………………………………………………………………………………………………

Stages in Polypeptide Synthesis

Transcription

This is the first stage of polypeptide synthesis that occurs in the nucleus

Definition of Transcription

The formation of a single stranded mRNA copy of the DNA coding strand

Requirements for mRNA synthesis

The gene to be transcribed

Free RNA nucleotides (stored in the nucleolus). The activated RNA nucleotides are ATP, GTP, CTP and UTP

RNA polymerase

8

Events in Transcription

1. A gene unwinds and unzips (catalysed by RNA polymerase). This occurs as the gene region dips into the nucleolus. Unzipping involves the breaking of hydrogen bonds between complementary base pairs of the two DNA strands

2. Only one DNA strand is copied into single stranded mRNA

3. Activated RNA nucleotides line up against the exposed complementary bases on the template strand of the DNA section. Hydrogen bonds form between the complementary bases: U binds to A, C to G and A to T

4. RNA polymerases catalyses the formation of phosphodiester bonds between the RNA nucleotides. The two extra phosphate groups of each RNA nucleotide are hydrolysed to release energy for phosphodiester bond formation

5. The mRNA produced is complementary to the template DNA strand of the gene but is a copy of the coding DNA strand of the gene

6. The mRNA is released from the DNA and passes out of the nucleus, through a nuclear pore in the nuclear envelope, to a ribosome in the cytoplasm

Complete the table below:

DNA coding strand

DNA template strand mRNA

Amino acid*

UUA AUG CGU

*use the genetic code to complete the amino acid row

Translation

GGA UAA0

Definition of Translation

Translation is the second stage of polypeptide synthesis when the amino acids are assembled into a polypeptide at a ribosome in the cytoplasm

The mRNA code consists of codons of 3 bases. The base/codon sequence in the mRNA determines the amino acid sequence

9

Revision of Ribosomes and tRNA

Ribosomes

Assembled in the nucleolus of eukaryote cells from ribosomal RNA (rRNA) and protein

Each ribosome has two subunits – one large and one small. The mRNA fits into a groove in the small subunit tRNA

tRNA molecules are made in the nucleus. They pass into the cytoplasm via the nuclear pores

tRNA is a single stranded length of RNA that folds into a clover leaf shaped structure

At one end, three unpaired bases bind a specific amino acid. At the other end, three unpaired bases form the anticodon that binds temporarily to the mRNA codon during translation

The function of tRNA molecules is to bring specific amino acids to the ribosome so that peptide bonds can be formed between the amino acids as a polypeptide is synthesised

Events during Translation

1. A molecule of mRNA fits in the groove of the ribosome. Two codons (6 bases) attach to the small ribosomal subunit

2. The first mRNA codon is always AUG – the start codon that codes for the amino acid methionine. A tRNA molecule carrying methionine has the anticodon UAC. This anticodon is complementary to the mRNA codon AUG.

Anticodon and codon bind as hydrogen bonds form between the complementary bases

3. A second tRNA carrying a different amino acid binds to the second exposed codon by complementary base pairing between codon and anticodon

4. A peptide bond forms between the two adjacent amino acids, catalysed by an enzyme in the small subunit

5. The ribosome now moves along the mRNA to the third codon. When this occurs, the mRNA slides through the ribosomal groove.

10

6. A third tRNA brings another amino acid and a peptide bond forms between the third amino acid and the dipeptide. The first tRNA leaves the ribosome and is available to collect another amino acid molecule in the cytoplasm

7. The polypeptide chain continues to be assembled until a stop codon on the mRNA is reached.

Role of Cyclic AMP in Activating Proteins cAMP activates proteins by changing their 3D shape to make them complementary to the molecule they bind to.

Reference was made to cAMP in F214 when its role in activating enzymes was described during the hormonal action of adrenaline on target cells

In muscle cells, the enzyme glycogen phosphorylase that hydrolyses glycogen to glucose, is activated by cAMP. cAMP binds to an allosteric site on glycogen phosphorylase so that its active site shape is more complementary and exposed to the glycogen substrate for efficient binding.

Protein Synthesis in Prokaryotes

Since the DNA is not contained within a nucleus, translation begins as soon as mRNA has been synthesised

Mutations

Definitions

A mutation is a random change in the nucleotide sequence of a DNA molecule

Mutagens , such as ionising radiation (X-rays, UV radiation) and certain chemicals

(eg benzopyrene in cigarette smoke) increase the chance of mutation

There are two categories of mutations

1. A chromosome mutation involves changes to parts or of whole chromosomes

2. A DNA/gene mutation is a change in the nucleotide base sequence within a gene

11

There are several types of DNA/gene mutation :

Substitution point mutations in which one base pair replaces another. If a substitution occurs in the first base pair of a triplet , it is likely to change one amino acid in the primary structure of a polypeptide. Changes to the second or third base are less likely to change the amino acid – these are silent mutations

Insertion and deletion mutations in which one or more nucleotide pairs are inserted or deleted from a length of DNA. These cause a frameshift

Stutter mutations where triplets are repeated . Huntington’s disorder is caused by a stutter mutation

Frameshift – this is a change in the reading frame of the coding DNA template and mRNA so that the amino acid sequence changes after the mutation. Frameshifts can have major effects on the polypeptide produced

– it may not function or be longer or shorter if a stop codon is removed or added

The effects of a deletion causing a frameshift mutation on a sequence of five amino acids

Coding DNA strand …. A T G T A C G G C T T A C G T T A G …….

Template DNA strand

…. T A C A T G C C G A A T G C A A T C ……. mRNA strand

…. A U G U A C G G C U U A C G U U A G…… amino acids met tyr gly leu arg stop

Effects of deletion of the fifth base pair

Coding DNA strand

…. A T G T C G G C T T A C G T T A G …….

Template DNA strand

….T A C A G C C G A A T G C A A T C ……. mRNA strand … A U G U C G G C U U A C G U U A G ….. amino acids met ser ala tyr val ser/arg

Note that deletion of one base pair alters the amino acid sequence after the mutation

12

Effects of Mutations and Examples

Consequences of

Mutation

Harmful mutations

Neutral mutations

Description

The amino acid sequence of the polypeptide is changed such that the protein no longer functions correctly

These have no effect on the fitness or survival of the organism

Useful mutations These produce alleles that are beneficial to the survival of the organism.

The alleles may be useful if there are changes in the environment

Examples/Types of mutation

Huntington disease due to a stutter mutation in the gene coding for

Huntington’s protein. The gene contains too many CAG sequences.

The symptoms of this disease include dementia and loss of motor control later in life

Cystic fibrosis 70% of cases are due to the deletion of a triplet of base pairs from the gene coding for normal polypeptide

Sickle cell anaemia results from a point mutation on codon 6 of the gene coding for the β-polypeptide of haemoglobin. Valine replaces glutamic acid in the polypeptide chain

Tumours due to a point mutation in proto-oncogenes - these genes are growth promoting genes. A point mutation changes the genes into oncogenes – they remain switched on permanently and cause unregulated cell division

Mutant triplet codes for the same amino acid (silent mutation)

Mutation occurs in non-coding regions of DNA and is not expressed in the phenotype

Triplet codes for a different amino acid but this makes no difference to the polypeptide function or gives no advantage or disadvantage to the organism eg some people have free ear lobes, some have attached

Antibiotic resistance in members of a bacterial population

The possession of one sickle cell anaemia allele in heterozygotes confers protection against the malarial parasite

13

The genetic control of protein production in a prokaryote using the lac operon

An operon is a group of genes that act together to control a biochemical pathway. The theory of the lac operon was described by Jacob and Monod in

1961. They received the Nobel prize for their research into the genetic control of protein production involved in lactose metabolism in Escherichia coli bacteria.

Background

Enzymes involved in basic cellular functions such as glycolysis are synthesised at a fairly constant rate

Inducible enzymes are synthesised at varying rates, according to environmental changes within the cell

Bacteria normally respire glucose but if there is no glucose available and lactose is present in the cell, they can respire lactose

The lac operon

The lac operon is a group of genes on a section of DNA that act together to produce the three enzymes required for lactose metabolism:

1. β galactosidase that catalyses lactose hydrolysis to glucose and galactose

2. Lactose permease that transports lactose into the cell

3. Another enzyme

Lactose is the inducer of the lac operon

Diagram showing the components of the lac operon and its regulator gene which is some distance away

14

Components of the lac operon and its regulator gene

Component of Functions

lac operon

Structural genes Z codes for β galactosidase that hydrolyses lactose

Y codes for lactose permease that increases uptake of lactose

A codes for another enzyme

All structural genes code for mRNA during transcription and code for the synthesis of enzymes

Operator gene

Promoter gene

Length of DNA next to the structural genes

Where repressor protein binds when there is no lactose in the medium

Does not code for a polypeptide

It can switch the structural genes on or off

Region of DNA to which RNA polymerase binds to begin transcription of Z,

Y and A

Does not code for a polypeptide

Regulator gene Not part of the operon region of DNA and some distance away

Codes for a repressor protein that has two binding sites, one for lactose when lactose is present in the medium and one for the operator region when there is no lactose in the medium

The regulatory gene controls the expression of the structural genes

When there is no lactose in the medium, the repressor protein product of the regulator gene switches the structural genes off. It does this by binding to the operator region preventing RNA polymerase binding with the promoter region.

15

How the lac operon works

Lactose absent from the growth medium

1 Regulator gene is expressed and the repressor protein is synthesised

Lactose present in the growth medium

1 Regulator gene is expressed and the repressor protein is synthesised

Lactose binds to the repressor protein causing the repressor protein to change shape

2 The repressor protein binds to the operator region, covering the promoter region where RNA polymerase normally binds

2 Repressor protein can no longer bind to the operator region and dissociates from it

5 Without mRNA, β galactosidase, lactose permease and the third enzyme cannot be synthesised

4 Benefits – energy and amino acids are saved

3 The promoter region is unblocked.

RNA polymerase can now bind to it allowing transcription of mRNA

4 for genes Z, Y and A

3 mRNA molecules for genes Z, Y and A are translate d to produce β galactosidase, lactose permease and the third enzyme

5 E.coli

bacteria can use lactose permease to take up lactose into the cells and β galactosidase to hydrolyse lactose to glucose and galactose. These two monosaccharides are respiratory substrates

Negative and positive control of the lac operon

Negative control by the repressor protein

Glucose is the preferred respiratory substrate. When glucose is present, the repressor protein binds to the operator gene and this prevents transcription of the structural genes. The repressor protein has a negative effect on structural gene transcription

Positive control by cyclic AMP receptor protein (CRP)

Even when lactose is available and no glucose, RNA polymerase does not bind readily to the promoter region of the operon. The protein CRP is needed to help the

16

binding of RNA polymerase to promoter region. CRP requires the attachment of cyclic AMP to change its 3D shape and expose its DNA binding site. Once bound to

DNA, the activated CRP helps RNA polymerase to bind to promoter to start transcription – activated CRP has a positive effect on structural gene transcription

Question

A strain of the bacterium Escherichia coli has been discovered that has a mutation in the regulator gene. One aspect of the phenotype of this mutant is that it produces large concentrations of β galactosidase at all times

1) Define the term phenotype

A phenotype is an observable characteristic of an individual due to interaction of its genotype with the environment.

2) Explain why a mutation in the regulator gene leads to a constant production of β galactosidase

The mutation was alter the DNA of the gene therefore there will be a change in how the regulatory gene would be expressed. Therefore, the repressor protein would no longer be complementary to the promoter region so RNA polymerase will bind to the promoter region. Then the operator gene would

‘turn on’ the structural genes and the enzymes beta-galactosidase and lactose permease would be created. There would be constant production due the promoter region being free from the repressor protein. It is possible that the repressor protein may not even be produced due to the change in DNA and change in AA sequence.

Answer:

Mutation causes alteration of the DNA of the regulator gene

Therefore repressor protein mRNA transcribed is altered

Either no repressor protein is synthesised or the protein has a different amino acid sequence

Structure and shape of the repressor protein could change

17

Such that the repressor protein is unable to bind to the operator region

The promoter region can bind to RNA polymerase

Transcription and translation of the structural genes continues

Homeobox genes controlling body plans

Definition of homeobox genes

Homeobox genes control the early development of the body plan of animals, plants and fungi. This control gives the pattern to the body including the polarity (positions of the head and tail), the segmentation pattern of insects and mammals and positioning of the organs.

Studies of the control of animal development

The fruit fly, Drosophila melanogaster , the zebra fish, Danio rerio and the mouse,

Mus musculus , have all been used by scientists to find out more about how genes control animal development. These organisms are ‘model organisms’

The information obtained from studying ‘model organisms’ can be applied to humans because:

1 Humans are in the same animal kingdom

2 All animals have eukaryotic cells

3 They have genes in common

4 They have common ancestors

5 They have similar embryonic development patterns

Characteristics of organisms chosen by scientists for studying gene control of development

1 Organisms have short life cycles and therefore mature and develop quickly

2 They are easy to breed, producing many offspring

3 Cheap to buy

4 Are common and readily available

5 Genome has already been sequenced as they have previously been well studied and many mutants are already known

Development of Drosophila melanogaster – the fruit fly

18

The genetic control of cell differentiation has been studied in the fruit fly, Drosophila melanogaster , an invertebrate animal

Drosophila development – see diagrams in textbook page 114

1. The single celled eggs undergo mitotic divisions at a very fast rate (less than

10mins each division)

2. No new plasma membranes are formed initially (no cytokinesis) and a multinucleated syncytium forms

3. After the 8 th division the nuclei migrate to the edges of the cell and by the 11 th division they form an outer layer around the central yolk

4. The division rate slows and the nuclear genes are transcribed

5. The plasma membrane invaginates around the 6000 nuclei forming an outer layer of 6000 cells

6. After 2-3 hours, the embryo divides into a series of segments

– these segments form the body plan of the fruit fly

7. 3 segments merge to produce the head. There are 3 thoracic segments (T1-

3) and 8 abdominal segments (A1-8)

8. When the larval form becomes the adult during metamorphosis, legs, wings and antennae appendages develop

19

20

Genetic control of Drosophila development

The development process described is controlled genetically by homeobox genes

Some genes determine which end is the head (anterior end) and which end is the tail (posterior end). This is referred to the embryo ’s polarity

The segmentation genes determine the polarity of each segment

Homeotic selector genes control the development of each individual segment

- these are the master genes

There are two sets of these master genes:

- The complex that controls development of thorax and abdominal segments

- The complex that controls development of head and thoracic segments

Mutations of these genes can change one body part to another. One example is antennapedia, where the antennae of Drosophila look more like legs

Genetic control of development in other organisms

Homeobox genes work in similar ways in other invertebrate animals, vertebrate animals (such as humans), plants and fungi

Features of the homeobox genes

Homeobox genes are homeotic or regulatory genes that contain homeobox nucleotide sequences

Each gene contains a sequence of 180 base pairs, producing a polypeptide containing 60 amino acids

Some of the polypeptides are transcription factors that bind to genes further along the DNA (upstream genes), starting transcription of the upstream genes. These transcription factors therefore control the expression of other genes, switching them on

The homeobox genes are arranged in clusters called Hox clusters. The more

Hox clusters an organism has, the more complex the organism is

- Roundworms (nematodes) have one Hox cluster

- Drosophila has two Hox clusters

- Vertebrates have four clusters of 9-11 genes on separate chromosomes

21

The increase in number of the Hox clusters probably derives from duplication of the single Hox cluster as found in the Nematodes

The homeobox genes are expressed in specific patterns in certain stages during embryo development, controlling body plan development and the differentiation of embryonic cells

Why homeobox genes are so similar across widely different species

Homeobox genes are vital to the development of an organism

Mutation would alter the body plan and have huge effects on the organism’s development

Mutations are likely to be lethal and selected against

Retinoic acid and birth deformities

Retinoic acid, a derivative of vitamin A is a morphogen that controls the pattern of tissue development

Retinoic acid activates homeobox genes in the same order that they are expressed, directing embryo development from head to tail

The concentration of dietary vitamin A is crucial. If pregnant women

(particularly in the first month of gestation) consume too much vitamin A the expression of these genes is abnormal resulting in birth defects. This is why pregnant women are now advised not to eat liver (liver stores vitamins A and

D)

Apoptosis ( pronounced apo-tosis)

Definition of apoptosis

Apoptosis is programmed cell death , an orderly process that occurs naturally in multicellular organisms. Normal body cells are not immortal and undergo a maximum number of about 50 mitotic divisions (the Hayflick limit). After this, the cells undergo a sequence of controlled biochemical processes to kill the cell

Necrosis is uncontrolled cell death that occurs during tissue infection or damage by trauma such as during a heart attack. The cell death is disorderly and associated with leakage of hydrolytic enzymes from cells that cause tissue damage and inflammation

22

Sequence of events in cells during apoptosis

1. Protease enzymes from lysosomes hydrolyse the cell’s cytoskeleton

2. Cell cytoplasm is dense with tightly packed organelles

3. Changes in the plasma membrane lead to the formation of small bulges called

‘blebs’

4. Chromatin in the nucleus condenses and the nuclear envelope breaks down.

DNA breaks down into fragments

5. The cell divides into separate membrane bound vesicles (the blebs start this process)

6. Phagocytes engulf these vesicles by phagocytosis

7. The useful cell molecules are recycled and the cellular waste products are removed safely so that they do not damage other cells/tissues. No hydrolytic enzymes are released into the tissues

23

Control of apoptosis

Control is complex and involves a network of both intracellular and extracellular cell signalling molecules that trigger an ordered sequence of changes in the cytoplasm

Cytokines secreted by T helper cells, hormones and nitric oxide are some of these molecules

Nitric oxide makes the inner mitochondrial membrane more permeable to hydrogen ions and this makes the proton gradient less steep

– reducing ATP synthesis

Functional living cells produce proteins that inhibit apoptosis. During cell death, other proteins are synthesised within the cell that bind to these inhibitory proteins. Apoptosis can then occur

The extracellular cell signalling molecules bind to receptors on the cell plasma membrane promoting a cascade of events in the cell including the activation of caspases that cause the breakdown of cytoskeleton proteins

Examples of apoptosis

Apoptosis is an important part of plant and animal tissue development. Too many cells are produced during development and some of these are removed by apoptosis

During development of the foot and hand, the finger and toe digits are separated by apoptosis. Apoptosis will be controlled by some Hox genes.

Mutations can cause this apoptosis to be incomplete so that the hands/feet are partially webbed

24

Apoptosis is also important throughout life. 20-30 billion cells per day undergo apoptosis in children between 8 and 14 years. In adults, 50-70 million cells apoptose. The rate of cells dying should equal the rate of cell production

Apoptosis is important when female mammals menstruate – the inner lining of the uterus is broken down

Killer T lymphocytes kill virus infected cells by inducing their apoptosis. After the killer T cells have fulfilled this function they must induce apoptosis in each other to prevent destruction of healthy body cells. Defects in this process result in an auto-immune response and destruction of healthy body tissues, such as in rheumatoid arthritis and multiple sclerosis

Apoptosis occurs in plants to remove cells infected with viruses

When a tadpole develops into a frog, apoptosis causes the tail to be lost

What happens if apoptosis rate is too low?

If mutations occur in the DNA controlling apoptosis, the cells continue to replicate and form a tumour . The rate at which new cells are produced by mitosis and cytokinesis is greater than the rate of cell death.

If some tumour cells break away and are transported in blood or lymph fluids, secondary cancers can occur in other parts of the body. These are called metastases and the cancerous tumour is malignant.

The human papilloma virus (HPV) causes genital warts. This virus can be transmitted sexually and can cause tumour formation in the female cervix. HPV interferes with a protein required for apoptosis.

25

Download